| Sequence ID | dm3.chr3R |
|---|---|
| Location | 27,269,721 – 27,269,787 |
| Length | 66 |
| Max. P | 0.784490 |
| Location | 27,269,721 – 27,269,787 |
|---|---|
| Length | 66 |
| Sequences | 3 |
| Columns | 66 |
| Reading direction | forward |
| Mean pairwise identity | 75.00 |
| Shannon entropy | 0.33011 |
| G+C content | 0.42713 |
| Mean single sequence MFE | -15.63 |
| Consensus MFE | -7.92 |
| Energy contribution | -7.37 |
| Covariance contribution | -0.55 |
| Combinations/Pair | 1.21 |
| Mean z-score | -2.41 |
| Structure conservation index | 0.51 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.68 |
| SVM RNA-class probability | 0.784490 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 27269721 66 + 27905053 UUGGAUGAAAAUGGUGCUGGUGAUGCUGGAAUGGAAAAGGGUCGACGCCUUUAUAUUCAAAUGGUA (((((((.(((.((((....((((.((..........)).)))).))))))).)))))))...... ( -14.10, z-score = -1.41, R) >droYak2.chr3R 28199669 56 + 28832112 UUGGCUGAAAGCGA----------GUGGGAAUUGAAAAGGGUCGACGCCUUUAUAGCCAAAUGAUA (((((((((((.(.----------((.((..((....))..)).)).))))).)))))))...... ( -16.40, z-score = -2.57, R) >droEre2.scaffold_4820 9755467 56 - 10470090 UUGGAUGAAAAGGA----------GUGGGAACGGAAAAGGUUCGAUGCCUUUAUAUCCAAAUGGUA (((((((.(((((.----------((.(((.(......).))).)).))))).)))))))...... ( -16.40, z-score = -3.24, R) >consensus UUGGAUGAAAACGA__________GUGGGAAUGGAAAAGGGUCGACGCCUUUAUAUCCAAAUGGUA (((((((.................((....))...(((((.......))))).)))))))...... ( -7.92 = -7.37 + -0.55)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:59:38 2011