| Sequence ID | dm3.chr3R |
|---|---|
| Location | 27,140,450 – 27,140,502 |
| Length | 52 |
| Max. P | 0.619466 |
| Location | 27,140,450 – 27,140,502 |
|---|---|
| Length | 52 |
| Sequences | 4 |
| Columns | 55 |
| Reading direction | forward |
| Mean pairwise identity | 75.70 |
| Shannon entropy | 0.38472 |
| G+C content | 0.44067 |
| Mean single sequence MFE | -14.32 |
| Consensus MFE | -8.59 |
| Energy contribution | -8.65 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.31 |
| Mean z-score | -1.58 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.26 |
| SVM RNA-class probability | 0.619466 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 27140450 52 + 27905053 CAGACUUUUAUGCCAGUGU---AGUCUUAGCUACAUUCUGGCGCGGUAAGAAAAG ....((((..(((((((((---(((....))))))..))))))..).)))..... ( -16.20, z-score = -2.60, R) >droSim1.chr3R 26779750 52 + 27517382 CAGACUUUUAUGCCAGUGU---AGUCUUAGCUACAUGCUGGCGCGGCGAGAAAAG ....((((..(((((((((---(((....)))))..)))))))..).)))..... ( -16.20, z-score = -1.51, R) >droSec1.super_4 5951005 52 + 6179234 CAGACUUUUAUGCCAGUGU---AGUCUUAGCUACAAGCUGGAGCGGCGAGAAAAG ....(((((.((((..(((---(((....)))))).((....))))))..))))) ( -14.40, z-score = -1.25, R) >droAna3.scaffold_13340 5021108 53 + 23697760 --AAUUUUUUUUUCAAUGUUUCAACAUUUGUUGGAUGCUGGUGAGGCAAGGAAAG --........((((..(((((((.((((.....))))....)))))))..)))). ( -10.50, z-score = -0.95, R) >consensus CAGACUUUUAUGCCAGUGU___AGUCUUAGCUACAUGCUGGCGCGGCAAGAAAAG ....((((..(((((((((...(((....)))..)))))))))..).)))..... ( -8.59 = -8.65 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:59:19 2011