| Sequence ID | dm3.chr3R |
|---|---|
| Location | 26,939,764 – 26,939,847 |
| Length | 83 |
| Max. P | 0.548565 |
| Location | 26,939,764 – 26,939,847 |
|---|---|
| Length | 83 |
| Sequences | 9 |
| Columns | 87 |
| Reading direction | reverse |
| Mean pairwise identity | 65.46 |
| Shannon entropy | 0.72427 |
| G+C content | 0.34811 |
| Mean single sequence MFE | -12.73 |
| Consensus MFE | -6.05 |
| Energy contribution | -5.48 |
| Covariance contribution | -0.56 |
| Combinations/Pair | 1.90 |
| Mean z-score | -0.46 |
| Structure conservation index | 0.47 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.11 |
| SVM RNA-class probability | 0.548565 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 26939764 83 - 27905053 AAGUUCUCAUAUUUAUGUACAAUAUUUUACCAUCGUUCGAACGCAAUUUAUUUUCGCUUUUAUUUAAUC-UAUUGUGUUUGCCG--- ..((...(((....))).)).................((((((((((..(((.............))).-.))))))))))...--- ( -8.92, z-score = -0.74, R) >droSim1.chr3R 26580459 83 - 27517382 AAAUUCUCAUAUUUAUGUACAAUAUUUUACCAUCGUUCGAACGCAAUUUAUUUGCGCUUUUAUUUAAUC-UAUUGUGUUUGCCG--- .................(((((((..(((...((....)).(((((.....)))))........)))..-))))))).......--- ( -9.90, z-score = -0.62, R) >droSec1.super_4 5758057 83 - 6179234 AAAUUCUCAUAUUUAUGUACAAUAUUUUACCAUCGUUCGAACGCAAUUUAUUUGCGCUUUUAUUUAAUC-UAUUGUGUUUGCCG--- .................(((((((..(((...((....)).(((((.....)))))........)))..-))))))).......--- ( -9.90, z-score = -0.62, R) >droYak2.chr3R 27873183 83 - 28832112 AAGUUAUCAUAUUUAUGCGCCAUAUUUUACCAUCGCUCGAAUGCAAUUUGUUUGCGCUCUUAUUUAAUC-UAUUGUGUUUGCCG--- ..((...((((.....(((..............)))..((.(((((.....))))).))..........-...))))...))..--- ( -8.54, z-score = 1.10, R) >droEre2.scaffold_4820 9422239 83 + 10470090 GAACUCUCAUAUUUAUGUACAAUAUUCUAGCAUCGUUCGAAUGCAAUUUAUUUGCGCUUUUAUUUAAUC-UAUUGUGUUUACAG--- ...............((((.(((((..(((........((((((((.....))))).)))........)-))..))))))))).--- ( -9.19, z-score = 0.16, R) >dp4.chr2 205653 83 - 30794189 AAAUUUACAUAUUUAUG-GUAUUUUUCCACCAU--UUCGAAUGCAAUUUAUCUGCGCUUUCAUUUAAUC-UAUUGUGUGUGUUUCCA .....(((((((..(((-((........)))))--...(((((((.......))))..)))........-....)))))))...... ( -10.80, z-score = -1.13, R) >droPer1.super_7 2991119 83 - 4445127 AAAUUUACAUAUUUAUG-GUAUUUUUCCACCAU--UUCGAAUGCAAUUUAUCUGCGCUUUCAUUUAAUC-UAUUGUGUGUGUUUCCA .....(((((((..(((-((........)))))--...(((((((.......))))..)))........-....)))))))...... ( -10.80, z-score = -1.13, R) >droMoj3.scaffold_6540 27121606 69 - 34148556 --------UCGUUGCCAUGGUGUA-UAAACCUUGCCCCGUGGGCCGCACGCUGCUGCUGCUCGUGC----UGUUGCACAUGC----- --------......((((((.(((-.......))).))))))...(((.((....)))))..((((----....))))....----- ( -22.40, z-score = 0.19, R) >droGri2.scaffold_14624 3961938 75 - 4233967 --------ACAUUUUCAUGGCAUAUUGCACUAU-AGCCAGUGGCAGUUUGCUGUUGCUGUUGUUAAUUUGUAAUGCGGCUGCCG--- --------..........(((((((((((...(-((((((..((((....))))..)))..))))...)))))))....)))).--- ( -24.10, z-score = -1.36, R) >consensus AAAUUCUCAUAUUUAUGUGCAAUAUUUUACCAUCGUUCGAAUGCAAUUUAUUUGCGCUUUUAUUUAAUC_UAUUGUGUUUGCCG___ .....................................((((((((((........................))))))))))...... ( -6.05 = -5.48 + -0.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:58:52 2011