| Sequence ID | dm3.chr2L |
|---|---|
| Location | 9,285,833 – 9,285,923 |
| Length | 90 |
| Max. P | 0.973155 |
| Location | 9,285,833 – 9,285,923 |
|---|---|
| Length | 90 |
| Sequences | 4 |
| Columns | 93 |
| Reading direction | forward |
| Mean pairwise identity | 81.06 |
| Shannon entropy | 0.30471 |
| G+C content | 0.32597 |
| Mean single sequence MFE | -20.52 |
| Consensus MFE | -12.47 |
| Energy contribution | -13.41 |
| Covariance contribution | 0.94 |
| Combinations/Pair | 1.24 |
| Mean z-score | -2.81 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.88 |
| SVM RNA-class probability | 0.973155 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 9285833 90 + 23011544 UUAAAACUGAGCUAUGAA---AAAUGCGCUCUAAGCAUAUCAGAGCGCUGUCCAUCAUAUAUUUACACAAGUUUUAUUAUAGCUCAGCACAAC ......((((((((((((---(((((((((((.........)))))))((.....)).............))))).)))))))))))...... ( -26.00, z-score = -4.25, R) >droSim1.chr2L 9062558 90 + 22036055 UUAAAACUGAGCUAUAAA---AAAUGCACUAUAAGCAUAUUAGAGCGCUGUCCAUCAUAUAUUUACAAAAGUUUUAUUAUAGCUCCGCACAAA ........(((((((((.---..((((.......))))..((((((..(((.............)))...)))))))))))))))........ ( -16.32, z-score = -1.68, R) >droSec1.super_3 4744698 90 + 7220098 UUAAAACUGAGCUAUAAA---AAAUGCACUAUAAGCAUAUUAGAGCGCUGCCCAUCAUAUAUUUACACAAGUUUUAUUAUAGCUCAGCACAAC ......(((((((((((.---..((((.......))))..((((((........................)))))))))))))))))...... ( -19.76, z-score = -2.76, R) >droEre2.scaffold_4929 9892956 92 + 26641161 UUAAAGCUGGGCUUUUAAUCUGCACGAAGAUUGAAUGCACUAUAA-GCUUCAUAUCAUUUAUUUACACAAGUUUUAUUAUAGCUCAGCACAAC .....((((((((((((((((......)))))))).((.......-))................................))))))))..... ( -20.00, z-score = -2.56, R) >consensus UUAAAACUGAGCUAUAAA___AAAUGCACUAUAAGCAUAUUAGAGCGCUGCCCAUCAUAUAUUUACACAAGUUUUAUUAUAGCUCAGCACAAC ......(((((((((((......((((.......))))..((((((........................)))))))))))))))))...... (-12.47 = -13.41 + 0.94)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:27:56 2011