| Sequence ID | dm3.chr3R |
|---|---|
| Location | 26,397,458 – 26,397,508 |
| Length | 50 |
| Max. P | 0.620539 |
| Location | 26,397,458 – 26,397,508 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 75.00 |
| Shannon entropy | 0.35025 |
| G+C content | 0.31765 |
| Mean single sequence MFE | -7.24 |
| Consensus MFE | -6.68 |
| Energy contribution | -6.47 |
| Covariance contribution | -0.21 |
| Combinations/Pair | 1.50 |
| Mean z-score | -0.64 |
| Structure conservation index | 0.92 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.27 |
| SVM RNA-class probability | 0.620539 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 26397458 50 - 27905053 AU-UUUUAGGGAAAAGCAGGAAAGAAGAAUUUCUAAUAAGUUUUCCAAUGA ..-.....((((((....(((((......)))))......))))))..... ( -8.00, z-score = -0.76, R) >droYak2.chr3R 27317181 51 - 28832112 AUAUAUUAGGGGAGAGCAGGGAAAAAGUAUUUCAAGAAAGUUCCACAGUUU ..........((((......((((.....)))).......))))....... ( -5.12, z-score = -0.51, R) >droSec1.super_4 5224239 50 - 6179234 AU-UUUAAGGGGAAAACAGGAAAGAAGAAUUUCUAGGAAGUUUCUCAAUGA ..-......((((((.(.(((((......))))).)....))))))..... ( -8.60, z-score = -0.66, R) >consensus AU_UUUUAGGGGAAAGCAGGAAAGAAGAAUUUCUAGAAAGUUUCACAAUGA ........((((((..(.(((((......))))).)....))))))..... ( -6.68 = -6.47 + -0.21)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:57:39 2011