Sequence ID | dm3.chr3R |
---|---|
Location | 25,512,113 – 25,512,176 |
Length | 63 |
Max. P | 0.619241 |
Location | 25,512,113 – 25,512,176 |
---|---|
Length | 63 |
Sequences | 6 |
Columns | 72 |
Reading direction | reverse |
Mean pairwise identity | 76.67 |
Shannon entropy | 0.41967 |
G+C content | 0.37931 |
Mean single sequence MFE | -12.68 |
Consensus MFE | -9.01 |
Energy contribution | -9.18 |
Covariance contribution | 0.17 |
Combinations/Pair | 1.47 |
Mean z-score | -1.03 |
Structure conservation index | 0.71 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.26 |
SVM RNA-class probability | 0.619241 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 25512113 63 - 27905053 --CAUUUAUUUAACGCAGGCCGGA-AAAUUCCGAUCAGGCUUGACUCAA-----UGUGUAC-CUUGAUAUAG --..........((((((..((((-....))))..)((......))...-----)))))..-.......... ( -10.00, z-score = -0.05, R) >droEre2.scaffold_4820 7980216 63 + 10470090 --CAUUUAUUUAACGCAGGUCGGA-AAAUUCCGAUCGGAGUUGACUCAA-----UGUGUAC-CUUGAUAUAG --..........((((((((((((-....))))))).(((....)))..-----)))))..-.......... ( -17.20, z-score = -2.61, R) >droYak2.chr3R 7871960 61 + 28832112 --CAUUUAUUUAACGCAGGUCUGA---AUUCCGAUCAGAGUUGACUCAA-----UGUGUAC-CUUGAUAUAG --..........(((((((((.(.---...).)))).(((....)))..-----)))))..-.......... ( -10.70, z-score = -0.62, R) >droSec1.super_4 4366903 63 - 6179234 --CAUUUAUUUAACGCAGGUCGGA-AAAUUCCGAUCGGGGUUGACUCAA-----UGUGUAC-CUUGAUAUAG --..........((((((((((((-....)))))))(((.....)))..-----)))))..-.......... ( -17.10, z-score = -2.22, R) >droSim1.chr3R 25184663 63 - 27517382 --CAUUUAUUUAACGCAGGUCGGA-AAAUUCCGAUCGGGGUUGACUCAA-----UGUGUAC-CUUGAUAUAG --..........((((((((((((-....)))))))(((.....)))..-----)))))..-.......... ( -17.10, z-score = -2.22, R) >droGri2.scaffold_15074 1835466 72 + 7742996 UAUUUUCCUCUGCCAUAUUUCAAAUUGAUUCUAAGGAAUUUUUGCUUAAGCUUGCGUAUACAUUUUAUAUAA ....(((((..(.((..........))...)..))))).....((........))(((((.....))))).. ( -4.00, z-score = 1.52, R) >consensus __CAUUUAUUUAACGCAGGUCGGA_AAAUUCCGAUCAGGGUUGACUCAA_____UGUGUAC_CUUGAUAUAG ............((((((((((((.....))))))).(((....))).......)))))............. ( -9.01 = -9.18 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:55:16 2011