| Sequence ID | dm3.chr2L |
|---|---|
| Location | 9,005,707 – 9,005,822 |
| Length | 115 |
| Max. P | 0.775014 |
| Location | 9,005,707 – 9,005,822 |
|---|---|
| Length | 115 |
| Sequences | 5 |
| Columns | 115 |
| Reading direction | forward |
| Mean pairwise identity | 56.18 |
| Shannon entropy | 0.82161 |
| G+C content | 0.32996 |
| Mean single sequence MFE | -24.62 |
| Consensus MFE | -8.62 |
| Energy contribution | -8.34 |
| Covariance contribution | -0.28 |
| Combinations/Pair | 1.60 |
| Mean z-score | -1.09 |
| Structure conservation index | 0.35 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.65 |
| SVM RNA-class probability | 0.775014 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 9005707 115 + 23011544 AAUUUGAGAGAAGGACUGAGAUCCUCUCUCACAUGUAUGAGCUCUGUAAAGAGUUCAUUAAAAAGAUCCCAUUCUUUGGAAUCACCAAAGAAGGUGGGAAUCUGUAUUUUAGGCA ....(((((((.(((......))))))))))..(((.((((((((....))))))))((((((((((((((((((((((.....)))))))..))))).))))...))))))))) ( -41.90, z-score = -4.27, R) >droSim1.chr2h_random 793237 111 + 3178526 UACUUUAGAAAUGCUCUC---UAUCAUCUUGUAUGAUUUAUUU-UUUAAAUAAUUCAGAGAAAAAGUCCAACUCUUUUUCUUCUUCAGUAAAGGUGGGAACUUGUAUUUUUGGUA ....((((((((((....---..(((((((...(((.(((((.-....))))).)))(((((((((.......)))))))))........)))))))......)))))))))).. ( -23.70, z-score = -2.15, R) >droSec1.super_80 44576 112 + 135508 AACUUAAAAUUUGCUUAG---UCAUCUCUUGCAUGAAAUAUUUCUUUAAAUAAUUCAAAGAAUAAGUCCCACUAUUUGACUUCUCCAGUAAAGGUAGGAACUUGUAUUUUUGGUU ((((.(((((.(((..((---......)).)))((((.(((((....))))).))))....((((((((.(((.....(((.....)))...))).)).))))))))))).)))) ( -14.90, z-score = 0.58, R) >droEre2.scaffold_4784 616759 92 - 25762168 -----------------------AUUAGAGAUGUGAUUUAUUUAUUUAAAUGAUUCAGAGAAUAAUUCCCAUUCUUUUCCUUCUCCAGUAAAGGUGGGAACUUGUAUUUUUGGUA -----------------------(((((((((((((.((((((....)))))).)))........(((((((.((((.(........).)))))))))))....)))))))))). ( -18.20, z-score = -0.48, R) >triCas2.singleUn_1817 15241 115 - 22356 AAUUUUUGAACCUUUGGGAGCGUGAGAUUUGAGUGAAUGAGCGAAUUGAACAUGUCUCUGAAUGCUAACCAUUUUUCGUAUGCACCGUCGAAAGUGGGCAAGUCAAUUUUGGGUA .........((((.(((.((((((((((.((..(.(((......))).).)).)))))...)))))..))).........(((.(((.(....)))))))..........)))). ( -24.40, z-score = 0.88, R) >consensus AACUUUAGAAAUGCUCUG___UCAUCUCUUGCAUGAAUUAUUUAUUUAAAUAAUUCAGAGAAUAAGUCCCAUUCUUUGUCUUCUCCAGUAAAGGUGGGAACUUGUAUUUUUGGUA ......................................................(((((((..(((((((((.((((............))))))))).))))...))))))).. ( -8.62 = -8.34 + -0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:27:24 2011