| Sequence ID | dm3.chr3R |
|---|---|
| Location | 23,904,015 – 23,904,068 |
| Length | 53 |
| Max. P | 0.723656 |
| Location | 23,904,015 – 23,904,068 |
|---|---|
| Length | 53 |
| Sequences | 5 |
| Columns | 55 |
| Reading direction | reverse |
| Mean pairwise identity | 67.09 |
| Shannon entropy | 0.60783 |
| G+C content | 0.32219 |
| Mean single sequence MFE | -7.76 |
| Consensus MFE | -4.54 |
| Energy contribution | -5.98 |
| Covariance contribution | 1.44 |
| Combinations/Pair | 1.38 |
| Mean z-score | -0.62 |
| Structure conservation index | 0.59 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.723656 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 23904015 53 - 27905053 ACCAAAUUUUUUGAUAUUUUUGU--GCGUGCUUUGCCAAAUUCAAAGAAAGAGCC ......((((((((....((((.--(((.....))))))).))))))))...... ( -10.10, z-score = -1.53, R) >apiMel3.Group1 25081919 52 - 25854376 ACGACGUUCCUUUAUUUUUCCAUUUCUCUUUUCGCUCUGAUUAAAAAUUACA--- ....................................................--- ( 0.00, z-score = 1.04, R) >droEre2.scaffold_4820 6327949 55 + 10470090 AUAAGACUAUUUAAUAUUUUUGGCAGCGUGCAUUGUCGAAUUCAAAUAAAGAGCC ......((.((((.....((((((((......))))))))......)))).)).. ( -5.60, z-score = 0.68, R) >droSec1.super_22 521637 55 - 1066717 AUUUAAUUUUUUGAUAUUUUUGUCAGCGUGCAUUGGCAAAUUCAAAGAAAGAGCC ......((((((((....((((((((......)))))))).))))))))...... ( -11.70, z-score = -1.71, R) >droSim1.chr3R 23603945 55 - 27517382 AUAUAAUUUUUUGAUAUUUUUGUCAGCGUGCAUUGGCGAAUUCAAAGAAAGAGCC ......((((((((....((((((((......)))))))).))))))))...... ( -11.40, z-score = -1.56, R) >consensus AUAAAAUUUUUUGAUAUUUUUGUCAGCGUGCAUUGGCAAAUUCAAAGAAAGAGCC ......((((((((....((((((((......)))))))).))))))))...... ( -4.54 = -5.98 + 1.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:49:52 2011