| Sequence ID | dm3.chr3R |
|---|---|
| Location | 23,657,032 – 23,657,124 |
| Length | 92 |
| Max. P | 0.575483 |
| Location | 23,657,032 – 23,657,124 |
|---|---|
| Length | 92 |
| Sequences | 6 |
| Columns | 94 |
| Reading direction | forward |
| Mean pairwise identity | 81.45 |
| Shannon entropy | 0.34658 |
| G+C content | 0.47870 |
| Mean single sequence MFE | -17.12 |
| Consensus MFE | -11.18 |
| Energy contribution | -12.21 |
| Covariance contribution | 1.03 |
| Combinations/Pair | 1.12 |
| Mean z-score | -1.54 |
| Structure conservation index | 0.65 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.17 |
| SVM RNA-class probability | 0.575483 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 23657032 92 + 27905053 GUUCCCGUCACACGUCAAUAUCCUUUUUGUGGUUUGGUUUUCCCUUGUUUUGCUUUUCCCCCGCCCCA-GUCCGGAAAGGCAAAAA-AGCAUUG ....(((...((((.............))))...)))......(((.((((((((((((...((....-))..)))))))))))))-))..... ( -18.82, z-score = -1.26, R) >droSim1.chr3R 23378359 88 + 27517382 GUCCCCGUCACACGUCAAUAUCCUUUUUGUGGUUU-----UCCCUUGUUUUGCUUUUCCCCCGCCCCAAGUCCGGAAAGGCAAAAA-AGCAUUG ..........((((.............))))....-----...(((.((((((((((((...((.....))..)))))))))))))-))..... ( -15.92, z-score = -1.29, R) >droSec1.super_22 294806 87 + 1066717 GUCCCCGUCACACGUCAAUAUCCUUUUUGUGGUUU-----UCCCUUGUUUUGCUUUUCCCCCGCCCCAAGUCCGGAAAGGCAAAAA-A-CAUUG ..........((((.............))))....-----.......((((((((((((...((.....))..)))))))))))).-.-..... ( -15.62, z-score = -1.37, R) >droYak2.chr3R 6000877 86 - 28832112 CUCCCCGUCACACGUCAAUAUCCUUUUUGUGGUUU-----UUCCUUGUUUUGCUUUUCCCGCCCCGCU---CCGGAAAAGCAAAAAAGGCAUUG ..........((((.............))))....-----..((((.((((((((((((.((...)).---..))))))))))))))))..... ( -19.42, z-score = -2.39, R) >droEre2.scaffold_4820 6086497 88 - 10470090 GUCCCCGUCACACGUCAAUAUCCUUUUUGUGGUUU-----UUCCUUGUUUUGCUUUUCCCCCGCCCCCAGGCCGGAAAAGCAAAAA-GGCAUUG ......(((.((((.............))))....-----.......((((((((((((...(((....))).)))))))))))).-))).... ( -23.72, z-score = -3.09, R) >droAna3.scaffold_13340 4662842 83 - 23697760 GUCCACGUCACACAUCAAUAUCCUUUUUGUGGUUC------UUUUUGUUUUGGAUAUCCCGCCGCACCAGACCCCCCUCAAAAAAAUUG----- .......................((((((.((.((------(...(((..(((.....)))..)))..)))....)).)))))).....----- ( -9.20, z-score = 0.14, R) >consensus GUCCCCGUCACACGUCAAUAUCCUUUUUGUGGUUU_____UCCCUUGUUUUGCUUUUCCCCCGCCCCAAGUCCGGAAAGGCAAAAA_AGCAUUG ..........((((.............))))................((((((((((((..............))))))))))))......... (-11.18 = -12.21 + 1.03)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:49:20 2011