Sequence ID | dm3.chr3R |
---|---|
Location | 23,546,130 – 23,546,186 |
Length | 56 |
Max. P | 0.995785 |
Location | 23,546,130 – 23,546,186 |
---|---|
Length | 56 |
Sequences | 3 |
Columns | 56 |
Reading direction | forward |
Mean pairwise identity | 83.93 |
Shannon entropy | 0.22508 |
G+C content | 0.68709 |
Mean single sequence MFE | -28.93 |
Consensus MFE | -24.88 |
Energy contribution | -26.33 |
Covariance contribution | 1.45 |
Combinations/Pair | 1.15 |
Mean z-score | -3.04 |
Structure conservation index | 0.86 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.84 |
SVM RNA-class probability | 0.995785 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 23546130 56 + 27905053 GUGGCAGUAGCAGUGGUAGUGGCAGCCAUGGCCAGUCGCCGCCACAGCCAUAGCCA .((((.((.((.((((..(((((.((....))..)))))..)))).)).)).)))) ( -26.00, z-score = -2.86, R) >droSec1.super_22 188671 51 + 1066717 -----AGUGGCAGUGGCUGUGCCAGCCAGGGCCAGUCGCCGCCACAGCCAGAGUCA -----.(((((.(((((((.(((......)))))))))).)))))........... ( -26.80, z-score = -3.29, R) >droSim1.chr3R 23275020 56 + 27517382 GUGGCAGUGGCAGUGGCUGUGGCAGCCAGGGCCAGUCGCCGCCGCAGCCACAGCCA .((((.(((((.(((((.(((((.((....))..))))).))))).))))).)))) ( -34.00, z-score = -2.98, R) >consensus GUGGCAGUGGCAGUGGCUGUGGCAGCCAGGGCCAGUCGCCGCCACAGCCACAGCCA ..(((.(((((.(((((.(((((.((....))..))))).))))).))))).))). (-24.88 = -26.33 + 1.45)
Location | 23,546,130 – 23,546,186 |
---|---|
Length | 56 |
Sequences | 3 |
Columns | 56 |
Reading direction | reverse |
Mean pairwise identity | 83.93 |
Shannon entropy | 0.22508 |
G+C content | 0.68709 |
Mean single sequence MFE | -26.90 |
Consensus MFE | -23.05 |
Energy contribution | -24.50 |
Covariance contribution | 1.45 |
Combinations/Pair | 1.06 |
Mean z-score | -2.49 |
Structure conservation index | 0.86 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.20 |
SVM RNA-class probability | 0.985412 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 23546130 56 - 27905053 UGGCUAUGGCUGUGGCGGCGACUGGCCAUGGCUGCCACUACCACUGCUACUGCCAC ((((..(((..((((((((.(.......).))))))))..)))..))))....... ( -23.80, z-score = -2.04, R) >droSec1.super_22 188671 51 - 1066717 UGACUCUGGCUGUGGCGGCGACUGGCCCUGGCUGGCACAGCCACUGCCACU----- ......((((.(((((.(.(.(..((....))..)).).))))).))))..----- ( -24.00, z-score = -2.09, R) >droSim1.chr3R 23275020 56 - 27517382 UGGCUGUGGCUGCGGCGGCGACUGGCCCUGGCUGCCACAGCCACUGCCACUGCCAC ((((.(((((((.((((((.(.......).)))))).))))))).))))....... ( -32.90, z-score = -3.34, R) >consensus UGGCUAUGGCUGUGGCGGCGACUGGCCCUGGCUGCCACAGCCACUGCCACUGCCAC ((((..(((((((((((((.(.......).)))))))))))))..))))....... (-23.05 = -24.50 + 1.45)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:49:00 2011