| Sequence ID | dm3.chr3R |
|---|---|
| Location | 23,398,478 – 23,398,532 |
| Length | 54 |
| Max. P | 0.676913 |
| Location | 23,398,478 – 23,398,532 |
|---|---|
| Length | 54 |
| Sequences | 6 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 77.28 |
| Shannon entropy | 0.44149 |
| G+C content | 0.47997 |
| Mean single sequence MFE | -12.95 |
| Consensus MFE | -7.62 |
| Energy contribution | -8.77 |
| Covariance contribution | 1.14 |
| Combinations/Pair | 1.21 |
| Mean z-score | -1.39 |
| Structure conservation index | 0.59 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.39 |
| SVM RNA-class probability | 0.676913 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 23398478 54 - 27905053 CCCCAGCGUGUUGUUUGCUUUUCGUUAAACGUUGCAAAGGGUCGGAAAAGCUGU ...((((.((((.(((((....((.....))..))))).)).)).....)))). ( -10.30, z-score = 0.53, R) >droWil1.scaffold_181089 3637171 53 - 12369635 CGCCCCCGUCCCCUCUCUUCAACCCAACACCUUGUGAAGUUUAUGAGUAAACA- .......((...(((.(((((...(((....)))))))).....)))...)).- ( -4.80, z-score = -0.63, R) >droSim1.chr3R 23129604 54 - 27517382 CCCCUGCGUGUUGUUUGCUUUUCGUUAAACGAUGCAAAGGGUCGGAAAAGCUGU .((((..((((((((((........))))))))))..))))............. ( -14.20, z-score = -1.20, R) >droSec1.super_22 32130 54 - 1066717 CCCCUGCGUGUUGUUUGCUUUUCGUUAAACAAUGCAAAGGGUCGGAAAAGCUGU .((((..((((((((((........))))))))))..))))............. ( -14.50, z-score = -1.50, R) >droYak2.chr3R 5742089 54 + 28832112 CCCCUGUGUGUUGUUUGCUUUUCGUUAAACGAUGCAGAGGGUCGGAAAAGCUGU .((((.(((((((((((........))))))))))).))))............. ( -18.00, z-score = -3.05, R) >droEre2.scaffold_4820 5830493 54 + 10470090 CCCCUGUGUGUUGUUUGCUUUUCGUUAAACGAUGCAAAGGGUCGGAAAAGCUGU .((((.(((((((((((........))))))))))).))))............. ( -15.90, z-score = -2.50, R) >consensus CCCCUGCGUGUUGUUUGCUUUUCGUUAAACGAUGCAAAGGGUCGGAAAAGCUGU .((((..((((((((((........))))))))))..))))............. ( -7.62 = -8.77 + 1.14)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:48:37 2011