| Sequence ID | dm3.chr2L |
|---|---|
| Location | 8,726,674 – 8,726,797 |
| Length | 123 |
| Max. P | 0.862986 |
| Location | 8,726,674 – 8,726,785 |
|---|---|
| Length | 111 |
| Sequences | 3 |
| Columns | 116 |
| Reading direction | forward |
| Mean pairwise identity | 54.23 |
| Shannon entropy | 0.63753 |
| G+C content | 0.38035 |
| Mean single sequence MFE | -30.33 |
| Consensus MFE | -9.12 |
| Energy contribution | -7.13 |
| Covariance contribution | -1.98 |
| Combinations/Pair | 1.67 |
| Mean z-score | -2.12 |
| Structure conservation index | 0.30 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.86 |
| SVM RNA-class probability | 0.836352 |
| Prediction | RNA |
Download alignment: ClustalW | MAF
>dm3.chr2L 8726674 111 + 23011544 --ACCUAACUAU---UUUAGAAUUUGGUUGUUUGAAAUUCAUUAACCAAGUUAGUGGUUUGUGAUCGGUGAUUAUAGUGAAUCUCCUGCCAAAGAGGUAGGGUCUGAAGUAUUGGA --..((((.(((---(((((((((((((((..((.....)).)))))))))....(((((((((((...))))))...)))))(((((((.....)))))))))))))))))))). ( -30.80, z-score = -2.57, R) >triCas2.ChLG10 1526835 111 + 8806720 --AUCUGACUAA---UUUAGAGUUAGGCUCUUUAAGCGAAAAAAGCCAUUUUAGUGGUUGAUGAUCGGUGACUAUUUUAAAUUUUCGUCCAUACAAAUAAGGGCGAAAAUAUUUGG --..((((((..---.....))))))(((.....)))((....((((((....)))))).....))(....)........((((((((((..........))))))))))...... ( -25.40, z-score = -1.71, R) >droAna3.scaffold_13333 673272 114 + 940145 AUCUCUCAAUACGCGCUGGAGGUUUGGAUG--UAGGCUUAAAAAUCGCUGCUAGUGGCUUAUGGUCCGUCACUAGUUCGAACUUUAGGCCCAUUAGGUAAAAAUAGAACCUCUCCA .................((((((((.((((--..((((((((..(((..(((((((((.........))))))))).)))..))))))))))))...........))))))))... ( -34.80, z-score = -2.07, R) >consensus __AUCUAACUAA___UUUAGAGUUUGGAUGUUUAAGCUUAAAAAACCAUGUUAGUGGUUUAUGAUCGGUGACUAUUUUGAAUUUUCGGCCAAACAGGUAAGGACAGAAAUAUUCGA ................(((((....((((..............))))........((((((.(((...............))).)))))).....................))))) ( -9.12 = -7.13 + -1.98)
| Location | 8,726,681 – 8,726,797 |
|---|---|
| Length | 116 |
| Sequences | 3 |
| Columns | 116 |
| Reading direction | forward |
| Mean pairwise identity | 56.03 |
| Shannon entropy | 0.62170 |
| G+C content | 0.39645 |
| Mean single sequence MFE | -32.83 |
| Consensus MFE | -9.69 |
| Energy contribution | -8.26 |
| Covariance contribution | -1.43 |
| Combinations/Pair | 1.61 |
| Mean z-score | -2.24 |
| Structure conservation index | 0.30 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.96 |
| SVM RNA-class probability | 0.862986 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 8726681 116 + 23011544 UAUUUUAGAAUUUGGUUGUUUGAAAUUCAUUAACCAAGUUAGUGGUUUGUGAUCGGUGAUUAUAGUGAAUCUCCUGCCAAAGAGGUAGGGUCUGAAGUAUUGGACCGCCCAUAUAA ........((((((((((..((.....)).)))))))))).((((..(((((((...)))))))(((.....((((((.....))))))(((..(....)..)))))))))).... ( -31.20, z-score = -2.22, R) >triCas2.ChLG10 1526842 116 + 8806720 UAAUUUAGAGUUAGGCUCUUUAAGCGAAAAAAGCCAUUUUAGUGGUUGAUGAUCGGUGACUAUUUUAAAUUUUCGUCCAUACAAAUAAGGGCGAAAAUAUUUGGUUGCCCAAACAA ......((((.....))))......((....((((((....)))))).....))((..((((......((((((((((..........))))))))))...))))..))....... ( -29.00, z-score = -2.37, R) >droAna3.scaffold_13333 673284 114 + 940145 GCGCUGGAGGUUUGGAUGU--AGGCUUAAAAAUCGCUGCUAGUGGCUUAUGGUCCGUCACUAGUUCGAACUUUAGGCCCAUUAGGUAAAAAUAGAACCUCUCCACUGCCCAGACCA (((.(((((.....((((.--.((((((((..(((..(((((((((.........))))))))).)))..))))))))))))((((.........))))))))).)))........ ( -38.30, z-score = -2.13, R) >consensus UAAUUUAGAGUUUGGAUGUUUAAGCUUAAAAAACCAUGUUAGUGGUUUAUGAUCGGUGACUAUUUUGAAUUUUCGGCCAAACAGGUAAGGACAGAAAUAUUCGACUGCCCAAACAA .........((((((............................((((((.(((...............))).)))))).....(((.................)))..)))))).. ( -9.69 = -8.26 + -1.43)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:26:44 2011