| Sequence ID | dm3.chr3R |
|---|---|
| Location | 21,939,500 – 21,939,616 |
| Length | 116 |
| Max. P | 0.862986 |
| Location | 21,939,500 – 21,939,616 |
|---|---|
| Length | 116 |
| Sequences | 3 |
| Columns | 116 |
| Reading direction | reverse |
| Mean pairwise identity | 56.03 |
| Shannon entropy | 0.62170 |
| G+C content | 0.39645 |
| Mean single sequence MFE | -32.83 |
| Consensus MFE | -9.69 |
| Energy contribution | -8.26 |
| Covariance contribution | -1.43 |
| Combinations/Pair | 1.61 |
| Mean z-score | -2.24 |
| Structure conservation index | 0.30 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.96 |
| SVM RNA-class probability | 0.862986 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 21939500 116 - 27905053 UAUUUUAGAAUUUGGUUGUUUGAAAUUCAUUAACCAAGUUAGUGGUUUGUGAUCGGUGAUUAUAGUGAAUCUCCUGCCAAAGAGGUAGGGUCUGAAGUAUUGGACCGCCCAUAUAA ........((((((((((..((.....)).)))))))))).((((..(((((((...)))))))(((.....((((((.....))))))(((..(....)..)))))))))).... ( -31.20, z-score = -2.22, R) >droAna3.scaffold_13333 266747 114 + 940145 GCGCUGGAGGUUUGGAUGU--AGGCUUAAAAAUCGCUGCUAGUGGCUUAUGGUCCGUCACUAGUUCGAACUUUAGGCCCAUUAGGUAAAAAUAGAACCUCUCCACUGCCCAGACCA (((.(((((.....((((.--.((((((((..(((..(((((((((.........))))))))).)))..))))))))))))((((.........))))))))).)))........ ( -38.30, z-score = -2.13, R) >triCas2.ChLG10 7279762 116 + 8806720 UAAUUUAGAGUUAGGCUCUUUAAGCGAAAAAAGCCAUUUUAGUGGUUGAUGAUCGGUGACUAUUUUAAAUUUUCGUCCAUACAAAUAAGGGCGAAAAUAUUUGGUUGCCCAAACAA ......((((.....))))......((....((((((....)))))).....))((..((((......((((((((((..........))))))))))...))))..))....... ( -29.00, z-score = -2.37, R) >consensus UAAUUUAGAGUUUGGAUGUUUAAGCUUAAAAAACCAUGUUAGUGGUUUAUGAUCGGUGACUAUUUUGAAUUUUCGGCCAAACAGGUAAGGACAGAAAUAUUCGACUGCCCAAACAA .........((((((............................((((((.(((...............))).)))))).....(((.................)))..)))))).. ( -9.69 = -8.26 + -1.43)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:44:51 2011