| Sequence ID | dm3.chr3R |
|---|---|
| Location | 21,844,431 – 21,844,521 |
| Length | 90 |
| Max. P | 0.818547 |
| Location | 21,844,431 – 21,844,521 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 96 |
| Reading direction | reverse |
| Mean pairwise identity | 89.83 |
| Shannon entropy | 0.18004 |
| G+C content | 0.53479 |
| Mean single sequence MFE | -22.30 |
| Consensus MFE | -17.72 |
| Energy contribution | -18.92 |
| Covariance contribution | 1.20 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.05 |
| Structure conservation index | 0.79 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.79 |
| SVM RNA-class probability | 0.818547 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 21844431 90 - 27905053 AUGAGGUCACGGCCUCAUUAGAUCCCCCAUACCGAUGGCCAUGCCCAUUGCCAUGGCAUACCCAU----ACUUAUGCCAUCCGAUUCCCAUCCC-- (((((((....)))))))..((((........((((((......))))))..((((((((.....----...))))))))..))))........-- ( -24.50, z-score = -2.20, R) >droSim1.chr3R 21695536 94 - 27517382 AUGAGGUCACGGCCUCAUUAGAUCCCCCAUACCGAUGGCCAUGCCCAUAGCCAUGGCAUACCCAUACACACUUAUGCCAUCCGAUUCCCAUCCC-- (((((((....)))))))..((((..........(((((.((....)).)))))((((((............))))))....))))........-- ( -22.90, z-score = -1.80, R) >droSec1.super_13 638913 90 - 2104621 AUGAGGUCACGGCCUCAUUAGAUCCCCCAUACCGAUGGCCAUGCCCAUAGCCAUGGCAUACCCAU----ACUUAUGCCAUCCGAUUCCCAUCCC-- (((((((....)))))))..((((..........(((((.((....)).)))))((((((.....----...))))))....))))........-- ( -24.00, z-score = -2.16, R) >droYak2.chr3R 4200609 92 + 28832112 AUGAGGUCACGGCCUCAUUAGAUCCCCCAUACCAAUGCGAAUGCCCAUUGCCAUGGCAUACCCAU----ACUUAUGCCAACCGAUUCCCAUCCGAU (((((((....)))))))..((((........(((((.(.....))))))...(((((((.....----...)))))))...)))).......... ( -21.20, z-score = -1.73, R) >droEre2.scaffold_4820 4268000 79 + 10470090 AUGAGGUCACGGCCUCAUUAGAUCCCCCA-----------AUGCCCAUAGCCAUGGCAUACCCAU----ACUUAUGCCAUCCGAUUCCCAUCCC-- (((((((....)))))))..((((.....-----------..((.....)).((((((((.....----...))))))))..))))........-- ( -18.90, z-score = -2.38, R) >consensus AUGAGGUCACGGCCUCAUUAGAUCCCCCAUACCGAUGGCCAUGCCCAUAGCCAUGGCAUACCCAU____ACUUAUGCCAUCCGAUUCCCAUCCC__ (((((((....)))))))..((((...........((((.((....)).))))(((((((............)))))))...)))).......... (-17.72 = -18.92 + 1.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:44:30 2011