| Sequence ID | dm3.chr3R |
|---|---|
| Location | 21,692,534 – 21,692,614 |
| Length | 80 |
| Max. P | 0.855542 |
| Location | 21,692,534 – 21,692,614 |
|---|---|
| Length | 80 |
| Sequences | 4 |
| Columns | 80 |
| Reading direction | reverse |
| Mean pairwise identity | 67.29 |
| Shannon entropy | 0.53134 |
| G+C content | 0.36003 |
| Mean single sequence MFE | -17.25 |
| Consensus MFE | -8.57 |
| Energy contribution | -8.70 |
| Covariance contribution | 0.13 |
| Combinations/Pair | 1.42 |
| Mean z-score | -1.56 |
| Structure conservation index | 0.50 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.93 |
| SVM RNA-class probability | 0.855542 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 21692534 80 - 27905053 UUUAAAUUUAAAUGCUUAGGCAUAUACAUUUUAAGCCUGCGCAAUUUAAAAAUGCUGCCGUACGACUUUUAAAAUACACC (((((((((((((((.(((((.((.......)).))))).)).)))))))..(((....))).....))))))....... ( -12.90, z-score = -0.77, R) >droSec1.super_13 471345 80 - 2104621 UUUAAAUGUAAAUGCUUAGGAAUAUACAUUUUAAGCCUGAGCAAUUUAAAAAUGCUGCCGUACGAAUUUUAAAAACCACC ............((((((((..((.......))..)))))))).(((((((.(((....)))....)))))))....... ( -12.70, z-score = -1.39, R) >droSim1.chr3R 21536088 80 - 27517382 UUUAAAUUUAAAUGCUUAGGCAUAUACAUUUUAAGCCUGAGCAAUUUAAAAAUGCUGCCGUACAAAUUUUAAAAUACACC (((((((((((((((((((((.((.......)).)))))))).)))))))..(((....))).....))))))....... ( -17.40, z-score = -2.30, R) >droGri2.scaffold_15116 876361 76 + 1808639 UCCCGAUUCAAAAGGUCGAAGGGCCA-ACUUGCAGCUGCCGCAAGUGCAACUUGUUGUUGCCGUCAGUCGGCUAACC--- ..((((((.....((((....)))).-((((((.......))))))(((((.....)))))....))))))......--- ( -26.00, z-score = -1.77, R) >consensus UUUAAAUUUAAAUGCUUAGGCAUAUACAUUUUAAGCCUGAGCAAUUUAAAAAUGCUGCCGUACGAAUUUUAAAAAACACC ((((((.......((((((((.((.......)).))))))))..........(((....))).....))))))....... ( -8.57 = -8.70 + 0.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:44:16 2011