| Sequence ID | dm3.chr3R |
|---|---|
| Location | 21,366,662 – 21,366,755 |
| Length | 93 |
| Max. P | 0.725448 |
| Location | 21,366,662 – 21,366,755 |
|---|---|
| Length | 93 |
| Sequences | 5 |
| Columns | 93 |
| Reading direction | reverse |
| Mean pairwise identity | 85.59 |
| Shannon entropy | 0.24843 |
| G+C content | 0.27088 |
| Mean single sequence MFE | -18.79 |
| Consensus MFE | -13.52 |
| Energy contribution | -13.60 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.08 |
| Mean z-score | -1.91 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.725448 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 21366662 93 - 27905053 AGAUAUAAAUGUUUCUCUUUUCCAAAUGGCAAAUGGUGAAUGCAAAUUGCGUACAUUUUGUAAAAUUUAUGCCAACAUUUGUAUUUAUUUUUA ((((((((((((..............(((((...(((...((((((.((....)).))))))..)))..)))))))))))))))))....... ( -18.83, z-score = -1.72, R) >droSim1.chr3R 21194347 92 - 27517382 AGAUAUAAAUGUUUCUCUUUUCCAAAUGGCAAAUGGCGAAUGCAAAUUGCGUACA-UUUGUAAAAUUUAUGCCAACAUUUGUAUUUAUUUUUA ((((((((((((..............((((((((.(((((((...........))-)))))...)))..)))))))))))))))))....... ( -18.83, z-score = -1.54, R) >droSec1.super_13 153138 93 - 2104621 AGAUAUAAAUGUUUCUCUUUUCCAAAUGGCAAAUGGCGAAUGCAAAUUGCGUACAUUUUGUAAAAUUUAUGCCAACAUUUGUAUUUAUUUUUA ((((((((((((.....(((.((....)).)))(((((.((((.....))))((.....))........)))))))))))))))))....... ( -18.30, z-score = -1.36, R) >droEre2.scaffold_4820 3792264 86 + 10470090 AGAUAUAAAUGUUCCGCUUCU-------GCAAAUGGCAAAUGCAAAUGGCGUACAUUUUGUAAAAUUUAUGCCAACAUUUGUAUUUAUUUUUA ((((((((((((...((...(-------((.....)))...))...(((((((.((((....)))).)))))))))))))))))))....... ( -23.50, z-score = -2.86, R) >droAna3.scaffold_13340 3621897 83 - 23697760 AGAUAUAAAUGUUUUCUGCCC----------GUUUCCAAAUGCAAAUUGCGUACAUUUUAUAAAAUUUAUGCCAACAUUUGUGUUUAUUUUUA (((((((((((((...(((..----------..........)))....(((((.((((....)))).))))).)))))))))))))....... ( -14.50, z-score = -2.05, R) >consensus AGAUAUAAAUGUUUCUCUUUUCCAAAUGGCAAAUGGCGAAUGCAAAUUGCGUACAUUUUGUAAAAUUUAUGCCAACAUUUGUAUUUAUUUUUA (((((((((((((......................((....)).....(((((.((((....)))).))))).)))))))))))))....... (-13.52 = -13.60 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:43:23 2011