| Sequence ID | dm3.chr3R |
|---|---|
| Location | 20,449,635 – 20,449,688 |
| Length | 53 |
| Max. P | 0.900790 |
| Location | 20,449,635 – 20,449,688 |
|---|---|
| Length | 53 |
| Sequences | 4 |
| Columns | 56 |
| Reading direction | forward |
| Mean pairwise identity | 68.50 |
| Shannon entropy | 0.49711 |
| G+C content | 0.36910 |
| Mean single sequence MFE | -11.43 |
| Consensus MFE | -5.89 |
| Energy contribution | -8.32 |
| Covariance contribution | 2.44 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.76 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.15 |
| SVM RNA-class probability | 0.900790 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 20449635 53 + 27905053 --GCAUUUAU-CAUUCCCUAAAUUGGGUGGGUUACACAUAAAUUUGGGGACUUCAC --........-...((((((((((..(((.....)))...))))))))))...... ( -16.40, z-score = -3.48, R) >droVir3.scaffold_13047 15011346 52 - 19223366 UCACGUUCACGUGUUUUCUUAAUUAAUUUUUUUACACGAAACAAUUUGUAUU---- ....(((..(((((...................))))).)))..........---- ( -4.71, z-score = -0.35, R) >droSec1.super_0 20784059 53 + 21120651 --GCAUUUAC-CAUUCCUUAAAUGGGGUGGGUUACACAUAAAUUUGGGGACUACAC --........-...(((((((((...(((.....)))....)))))))))...... ( -12.30, z-score = -1.61, R) >droSim1.chr3R 20288397 53 + 27517382 --GCAUUUAC-CAUUCCUUAAAUGGGGUGGGUUACACAUAAAUUUGGGGACUACAC --........-...(((((((((...(((.....)))....)))))))))...... ( -12.30, z-score = -1.61, R) >consensus __GCAUUUAC_CAUUCCCUAAAUGGGGUGGGUUACACAUAAAUUUGGGGACUACAC ..............((((((((((..(((.....)))...))))))))))...... ( -5.89 = -8.32 + 2.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:41:15 2011