| Sequence ID | dm3.chr3R |
|---|---|
| Location | 20,304,070 – 20,304,166 |
| Length | 96 |
| Max. P | 0.830706 |
| Location | 20,304,070 – 20,304,166 |
|---|---|
| Length | 96 |
| Sequences | 6 |
| Columns | 100 |
| Reading direction | reverse |
| Mean pairwise identity | 82.59 |
| Shannon entropy | 0.31502 |
| G+C content | 0.40246 |
| Mean single sequence MFE | -18.95 |
| Consensus MFE | -14.69 |
| Energy contribution | -14.55 |
| Covariance contribution | -0.14 |
| Combinations/Pair | 1.26 |
| Mean z-score | -1.61 |
| Structure conservation index | 0.77 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.83 |
| SVM RNA-class probability | 0.830706 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 20304070 96 - 27905053 UUGUUUUCCAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUUCCCCUGGGCU----CUUGCUUCUGCUCCUGCUCCAGC ....................((((..(((((((((((....))))))..)))).)..)))).....((((((.----...((....))....)).)))). ( -21.90, z-score = -1.91, R) >droAna3.scaffold_13088 345697 77 - 569066 UUGUUUUCGAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUUGUGGUUAUUCA--AGGGCU---GACUGC------------------ ...............(((((.(((..(((((((((((....))))))...)))))..)))....)--))))..---......------------------ ( -15.50, z-score = -0.93, R) >droEre2.scaffold_4820 2715448 97 + 10470090 UUGUUUUGCAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUUCCCCUGGGUUUUUCCUUGCCCCUGCUCCUGCUGC--- ..((...((((.........((((..(((((((((((....))))))..)))).)..)))).......((((........))))))))....))...--- ( -23.10, z-score = -2.44, R) >droYak2.chr3R 2634342 85 + 28832112 UUGUUUUCCAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUUCUCCAGGGCU----CUUGCUCCCACU----------- ....................((((..(((((((((((....))))))..)))).)..)))).......((((.----...)))).....----------- ( -16.30, z-score = -1.17, R) >droSec1.super_0 20640184 87 - 21120651 UUGUUUUCCAGAAAUUCCUUAAGCUGCAAGAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUUCCUCUGGGCU----CUUGCUCCUGCCCC--------- .......(((((........((((..(((((((((((....))))))..)))).)..))))....)))))((.----...)).........--------- ( -19.10, z-score = -1.60, R) >droSim1.chr3R 20144872 87 - 27517382 UUGUUUUCCAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUCCCCCUGGGCU----CUUGCUCCUGCUAC--------- ........(((.........((((..(((((((((((....))))))..)))).)..)))).......((((.----...)))))))....--------- ( -17.80, z-score = -1.62, R) >consensus UUGUUUUCCAGAAAUUCCUUAAGCUGCAAAAUGUUUGUUAUCAAACAAUUUUUCGUGGCUUUUCCCCUGGGCU____CUUGCUCCUGCUCC_________ ....................((((..(((((((((((....))))))..)))).)..)))).......((((........))))................ (-14.69 = -14.55 + -0.14)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:40:49 2011