Sequence ID | dm3.chr3R |
---|---|
Location | 20,176,133 – 20,176,188 |
Length | 55 |
Max. P | 0.902923 |
Location | 20,176,133 – 20,176,188 |
---|---|
Length | 55 |
Sequences | 6 |
Columns | 59 |
Reading direction | reverse |
Mean pairwise identity | 79.88 |
Shannon entropy | 0.37778 |
G+C content | 0.42399 |
Mean single sequence MFE | -15.07 |
Consensus MFE | -8.19 |
Energy contribution | -8.00 |
Covariance contribution | -0.19 |
Combinations/Pair | 1.40 |
Mean z-score | -2.30 |
Structure conservation index | 0.54 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.17 |
SVM RNA-class probability | 0.902923 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 20176133 55 - 27905053 UACAAUCAAGGGUAGGUUGGCUUC----GGGAACCGAAGUUUCAAAUACUUUUGCAGCC ......((((((((....((((((----((...)))))))).....))))))))..... ( -16.10, z-score = -2.44, R) >dp4.chr2 12161683 59 + 30794189 AACACUUAAAAAUACUUUUUUUUUCGUAUGGAUUCCAAGGAAAAAAUAACUUGGUAUCC ...((..(((((......)))))..))..((((.(((((..........))))).)))) ( -10.80, z-score = -1.91, R) >droSim1.chr3R 20010526 55 - 27517382 UACAAUCAAGGGUAGGCUGGCUUC----GGGAACCGAAGUUUCAAAUACUUUUGCAACC ......((((((((....((((((----((...)))))))).....))))))))..... ( -16.10, z-score = -2.57, R) >droSec1.super_0 20514662 55 - 21120651 UACAAUCAAGGGUAGGUUGGCUUC----GGGAACCAAAGUUUCAAAUACUUUUGCAGCC ......((((((((....(((((.----((...)).))))).....))))))))..... ( -10.20, z-score = -0.24, R) >droEre2.scaffold_4820 2585563 55 + 10470090 UACAAUCAAGGGUAGGUUGGCUUC----GGGAACCGAAGUUUCAAAUACUCUUGCACCC ......((((((((....((((((----((...)))))))).....))))))))..... ( -18.60, z-score = -3.03, R) >droYak2.chr3R 2502768 55 + 28832112 UACAAUCAAGGGUAGGUUGGCUUC----GGGAACCGAAGUUUCAAAUACUCUUGCAACC ......((((((((....((((((----((...)))))))).....))))))))..... ( -18.60, z-score = -3.61, R) >consensus UACAAUCAAGGGUAGGUUGGCUUC____GGGAACCGAAGUUUCAAAUACUUUUGCAACC ......((((((((....((((((....(....).)))))).....))))))))..... ( -8.19 = -8.00 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:40:16 2011