| Sequence ID | dm3.chr3R |
|---|---|
| Location | 19,612,544 – 19,612,637 |
| Length | 93 |
| Max. P | 0.523111 |
| Location | 19,612,544 – 19,612,637 |
|---|---|
| Length | 93 |
| Sequences | 5 |
| Columns | 101 |
| Reading direction | reverse |
| Mean pairwise identity | 64.18 |
| Shannon entropy | 0.58485 |
| G+C content | 0.33436 |
| Mean single sequence MFE | -14.85 |
| Consensus MFE | -4.13 |
| Energy contribution | -3.97 |
| Covariance contribution | -0.16 |
| Combinations/Pair | 1.43 |
| Mean z-score | -2.07 |
| Structure conservation index | 0.28 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.06 |
| SVM RNA-class probability | 0.523111 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 19612544 93 - 27905053 CGAGCUU---UUAUGAGCUAAGCCCCCAAAGCGUUUUCUAUAUAUAUAUUCCCCUAUAUAUGUUUGUAUAUAUAC---CACAUACGCUUUUAAUUGCCU-- ..(((((---....)))))..((....(((((((....((((((((((..(..........)..)))))))))).---.....))))))).....))..-- ( -18.40, z-score = -3.40, R) >droSec1.super_0 19970758 90 - 21120651 CGAGCUU---UUAUGAGCUAAGCCCCUAAAGCGUUUUCUAAAUAUAUG------UAUAUAUUCUCCUUUAUAUAUACACACACACGCUUUUAAUUGCCC-- ..(((((---....)))))..((....(((((((............((------(((((((........))))))))).....))))))).....))..-- ( -17.33, z-score = -3.32, R) >droYak2.chr3R 20519322 81 - 28832112 --AGCUCAUACUAUGAGCUAAGCCCCUAAAGCGUUUUCUAUAUAUAUA------UAUUUGUUCUGCUAUAUAU----------ACGUUUUUAAUUGCCC-- --(((((((...)))))))..((....(((((((.....(((((((..------............)))))))----------))))))).....))..-- ( -13.84, z-score = -1.44, R) >droEre2.scaffold_4820 2038906 76 + 10470090 CGAGCUU---UUAUGAGCUAAGCCCCUAAAGCGUUUUC------UAUA------UAUAUAUUCUGCUAUAUAUAU--------ACGUUUUUAAUUGCCC-- ..(((((---....)))))..((....(((((((....------.(((------((((((......)))))))))--------))))))).....))..-- ( -15.20, z-score = -2.27, R) >droMoj3.scaffold_6540 21019297 81 + 34148556 CGACUCC---CAACGAUCAUAAUUGC--GAUUGUUUGUUGUGCAUAUA------CAUAUAUACAUACAUAGUUA---------ACGCUUUUAACAAUUCUC .......---.(((((((........--)))))))(((.(((.((((.------...)))).))))))..((((---------(.....)))))....... ( -9.50, z-score = 0.10, R) >consensus CGAGCUU___UUAUGAGCUAAGCCCCUAAAGCGUUUUCUAUAUAUAUA______UAUAUAUUCUGCUAUAUAUA_________ACGCUUUUAAUUGCCC__ ..(((((.......)))))..((....(((((((.................................................))))))).....)).... ( -4.13 = -3.97 + -0.16)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:38:49 2011