| Sequence ID | dm3.chr3R |
|---|---|
| Location | 19,460,103 – 19,460,166 |
| Length | 63 |
| Max. P | 0.710714 |
| Location | 19,460,103 – 19,460,166 |
|---|---|
| Length | 63 |
| Sequences | 6 |
| Columns | 75 |
| Reading direction | reverse |
| Mean pairwise identity | 65.99 |
| Shannon entropy | 0.60068 |
| G+C content | 0.34503 |
| Mean single sequence MFE | -12.40 |
| Consensus MFE | -5.78 |
| Energy contribution | -6.83 |
| Covariance contribution | 1.06 |
| Combinations/Pair | 1.25 |
| Mean z-score | -1.14 |
| Structure conservation index | 0.47 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.48 |
| SVM RNA-class probability | 0.710714 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 19460103 63 - 27905053 AUUAUCU--AAACGCUU--------AAAUACCCUUGUU-AUCUGCGGAUAAAGGGUAUUUAAAAAAUC-CUUGGC .......--......((--------((((((((((..(-(((....))))))))))))))))......-...... ( -15.80, z-score = -3.10, R) >droSim1.chr3R 19289382 65 - 27517382 AUUACCUAUAUAUGCUU--------AAAUACCCUUGUU-AUCUGCGGGUAAAGGGUAUUAAAAAAAUC-CUUGGC ....((...........--------.(((((((((..(-(((....))))))))))))).........-...)). ( -12.45, z-score = -0.60, R) >droSec1.super_0 19817355 73 - 21120651 AUUACCUAUAUAUGCUUAAAUACCCAAAUACCCUUGUU-AUCUGCGGGUAAAGGGUAUUAAAAAAAUC-CUUGGC ....((............(((((((...(((((..((.-....)))))))..))))))).........-...)). ( -14.85, z-score = -1.01, R) >droYak2.chr3R 20355017 66 - 28832112 UAUAAUGGAAUAUGCUA--------AAAUACCCUUGUU-AUCUGCGGACAAGAGGUAUUCAAAAAAUCAUUUGGC .............((((--------(((((((((((((-.......)))))).)))))...........)))))) ( -13.00, z-score = -1.58, R) >droEre2.scaffold_4820 1883757 60 + 10470090 ------GAAAUAUGCUG--------AAAUACCCUAGUU-AUCUGCGGAUAAGGGGUAUUCAAAAAAUCAUUUGGC ------.........((--------((.((((((..((-(((....))))))))))))))).............. ( -13.40, z-score = -1.79, R) >droVir3.scaffold_13047 9060633 59 - 19223366 ---------AUUCUCUUAA------AGCCACACUAUUCGAUCAGGGUGUCAAAAAUAUUUAUCAGGGACAUUGA- ---------..((((((((------(...(((((..........)))))........))))..)))))......- ( -4.90, z-score = 1.26, R) >consensus AUUA_CUA_AUAUGCUU________AAAUACCCUUGUU_AUCUGCGGAUAAAGGGUAUUAAAAAAAUC_CUUGGC ..........................(((((((((....(((....))).)))))))))................ ( -5.78 = -6.83 + 1.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:38:38 2011