| Sequence ID | dm3.chr3R |
|---|---|
| Location | 19,271,452 – 19,271,519 |
| Length | 67 |
| Max. P | 0.995691 |
| Location | 19,271,452 – 19,271,519 |
|---|---|
| Length | 67 |
| Sequences | 4 |
| Columns | 69 |
| Reading direction | forward |
| Mean pairwise identity | 57.53 |
| Shannon entropy | 0.67676 |
| G+C content | 0.27661 |
| Mean single sequence MFE | -12.45 |
| Consensus MFE | -5.57 |
| Energy contribution | -6.95 |
| Covariance contribution | 1.38 |
| Combinations/Pair | 1.12 |
| Mean z-score | -2.14 |
| Structure conservation index | 0.45 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.83 |
| SVM RNA-class probability | 0.995691 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 19271452 67 + 27905053 UUAGUUUUUUUUAACUAUUCAAUAACUUUUUACCAAUUAGACAUUUGUCUCCUUUAAUAGGAGGCAU-- .(((((......)))))............................((((((((.....)))))))).-- ( -13.70, z-score = -3.76, R) >droSec1.super_0 19634264 64 + 21120651 UUGGGUUUUU--AACCUUUUAAUAACUUUUUAUCUAUUAAACAUUUGUCUCCUUUAAUAGGAGGCA--- ..((((....--.))))(((((((..........)))))))....((((((((.....))))))))--- ( -13.60, z-score = -2.74, R) >droSim1.chr3R 19089663 67 + 27517382 UUAGGUUUUU--AACUUUUUAAUAACUUGUUACCAAUUAAACAUUUGUCUCCUAUAAUAGGAGGCAUAU .((((((.((--((....)))).))))))................(((((((((...)))))))))... ( -14.70, z-score = -3.02, R) >droGri2.scaffold_15074 7013893 63 - 7742996 -CGUAUUGCAUUAAAUGAUUAUUGUUAUAAAAUCGCCAGAGUGUGUGUAAAUGUCGACUUGCAU----- -.....((((.....((((.....(((((....(((....)))..)))))..))))...)))).----- ( -7.80, z-score = 0.98, R) >consensus UUAGGUUUUU__AACUUUUUAAUAACUUUUUACCAAUUAAACAUUUGUCUCCUUUAAUAGGAGGCA___ .............................................((((((((.....))))))))... ( -5.57 = -6.95 + 1.38)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:37:55 2011