| Sequence ID | dm3.chr3R |
|---|---|
| Location | 18,496,674 – 18,496,730 |
| Length | 56 |
| Max. P | 0.667762 |
| Location | 18,496,674 – 18,496,730 |
|---|---|
| Length | 56 |
| Sequences | 12 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 87.74 |
| Shannon entropy | 0.27737 |
| G+C content | 0.34824 |
| Mean single sequence MFE | -7.61 |
| Consensus MFE | -6.85 |
| Energy contribution | -6.73 |
| Covariance contribution | -0.12 |
| Combinations/Pair | 1.25 |
| Mean z-score | -0.99 |
| Structure conservation index | 0.90 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.38 |
| SVM RNA-class probability | 0.667762 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 18496674 56 - 27905053 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droSim1.chr3R 18307335 56 - 27517382 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droSec1.super_0 18854037 56 - 21120651 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droYak2.chr3R 19347284 56 - 28832112 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droEre2.scaffold_4820 890539 56 + 10470090 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUC .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.68, R) >droAna3.scaffold_13340 15570054 56 + 23697760 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUG ................(((((((.((((((((......))))))))...))))))) ( -7.70, z-score = -0.75, R) >dp4.chr2 12569199 56 - 30794189 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droPer1.super_0 3924709 56 + 11822988 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU .................((((((.((((((((......))))))))...)))))). ( -6.80, z-score = -0.55, R) >droWil1.scaffold_181089 6174331 53 + 12369635 CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCUCUCGCGAUUUGCACAAAGUU--- ........................((((((((......)))))))).......--- ( -7.20, z-score = -1.31, R) >droVir3.scaffold_12855 7780111 56 + 10161210 CCAAUAAACCGACGUUAAAAAUUAUGUAAAUCGCGCCCGAUUUGCAAAAAGUUACU ........................(((((((((....))))))))).......... ( -9.00, z-score = -2.10, R) >droMoj3.scaffold_6540 34076308 56 - 34148556 CCAAUAGGCUGACAUUAAAAAUGAUACAACUAGCAGCCGAUUUGUAAAAAGUUUCU .(((..(((((......................)))))...)))............ ( -7.55, z-score = -0.77, R) >droGri2.scaffold_15074 5354057 56 + 7742996 CCAAUAAGCCAGCGUUAAAAAUUAUGCAAAUCGCGCCCGAUUUGCAAAAAGUAACU .............((((.......(((((((((....))))))))).....)))). ( -12.30, z-score = -3.03, R) >consensus CCAAUAAGCCAGCAUUUAAAAUUAUGUAAAUCCAGCGCGAUUUGCACAAAGUUUUU ........................((((((((......)))))))).......... ( -6.85 = -6.73 + -0.12)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:35:51 2011