| Sequence ID | dm3.chr2L |
|---|---|
| Location | 17,778 – 17,878 |
| Length | 100 |
| Max. P | 0.516824 |
| Location | 17,778 – 17,878 |
|---|---|
| Length | 100 |
| Sequences | 5 |
| Columns | 101 |
| Reading direction | reverse |
| Mean pairwise identity | 54.19 |
| Shannon entropy | 0.75090 |
| G+C content | 0.32079 |
| Mean single sequence MFE | -17.73 |
| Consensus MFE | -4.16 |
| Energy contribution | -3.96 |
| Covariance contribution | -0.20 |
| Combinations/Pair | 1.78 |
| Mean z-score | -1.77 |
| Structure conservation index | 0.23 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.04 |
| SVM RNA-class probability | 0.516824 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 17778 100 - 23011544 AAUGUAUGUAUACGGUAUACAGUCUUCGAAAAAAUAUUAGUACCGACCAGCUAGCGUUUGCCUAAA-ACGCUUUUACAAAAAUAAACGUAUAUGUUUUAAG .((((((((...((((((.....................)))))).......(((((((.....))-))))).............))))))))........ ( -19.10, z-score = -1.36, R) >droSec1.super_14 25727 86 - 2068291 AAUGUAUGUAUACGGUACACAGUCUUAGAUAAAAUAUUAGUACCGAUCAGAUAGCGUUUGCCUAAA-ACGCUUUUACAUGUGUAAAG-------------- .(..((((((..((((((.....................)))))).......(((((((.....))-)))))..))))))..)....-------------- ( -20.70, z-score = -2.39, R) >droSim1.chr2L 24241 86 - 22036055 AAUGUAUGUAUACGGUACACAGUCUUAGAUAAAAUAUUAGUACCGAUCAGAUAGCGUUUGCCUAAA-ACGCUUUUACAUGUGUAAAG-------------- .(..((((((..((((((.....................)))))).......(((((((.....))-)))))..))))))..)....-------------- ( -20.70, z-score = -2.39, R) >droVir3.scaffold_13246 80284 83 - 2672878 -AGAUGGCUUCUUGUCACGCAUGCU---AUACAAACUGGCUAGUAGUAAACUAAUACUUUCAUAAAUAUACCUAUGUAUAAGUUUAU-------------- -...((((.....))))....((((---(..(.....)..)))))(((((((.((((..................)))).)))))))-------------- ( -12.07, z-score = 0.37, R) >droMoj3.scaffold_6500 32123870 81 + 32352404 -AGACAUAUGUAUGUUCCCCCUGC----AGAAUAUAUU-UUAAUAUUUAGAGUAGAAUUUAAGGUAGAAAUAUGCAGAUGAGUGAAU-------------- -...(((.(((((((((..(((..----.((((.((((-(((.....)))))))..)))).)))..).)))))))).))).......-------------- ( -16.10, z-score = -3.09, R) >consensus AAUGUAUGUAUACGGUACACAGUCUU_GAUAAAAUAUUAGUACCGAUCAGAUAGCGUUUGCCUAAA_ACGCUUUUACAUGAGUAAAG______________ ....((((((..((((((.....................)))))).......(((((.(......).)))))..))))))..................... ( -4.16 = -3.96 + -0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:04:53 2011