| Sequence ID | dm3.chr3R |
|---|---|
| Location | 17,423,391 – 17,423,447 |
| Length | 56 |
| Max. P | 0.846101 |
| Location | 17,423,391 – 17,423,447 |
|---|---|
| Length | 56 |
| Sequences | 7 |
| Columns | 56 |
| Reading direction | forward |
| Mean pairwise identity | 93.03 |
| Shannon entropy | 0.12902 |
| G+C content | 0.53571 |
| Mean single sequence MFE | -20.00 |
| Consensus MFE | -16.12 |
| Energy contribution | -16.86 |
| Covariance contribution | 0.74 |
| Combinations/Pair | 1.11 |
| Mean z-score | -2.21 |
| Structure conservation index | 0.81 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.89 |
| SVM RNA-class probability | 0.846101 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 17423391 56 + 27905053 GCCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUCGUAUAAUGUCGCCGGCGAUCUC ((((((.(((((((((...(((.....)))...))))))))).).)))))...... ( -23.60, z-score = -3.37, R) >droSim1.chr3R 23472654 56 - 27517382 GCCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUCGUAUAAUGUCGCCGGCGAUCUC ((((((.(((((((((...(((.....)))...))))))))).).)))))...... ( -23.60, z-score = -3.37, R) >droSec1.super_6 292500 56 - 4358794 GCCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUCGUAUAAUGUCGCCGGCGAUCUC ((((((.(((((((((...(((.....)))...))))))))).).)))))...... ( -23.60, z-score = -3.37, R) >droYak2.chr3R 6261417 56 + 28832112 GCCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUCGUAUAAUGUCGCCGGCGAUCUC ((((((.(((((((((...(((.....)))...))))))))).).)))))...... ( -23.60, z-score = -3.37, R) >droEre2.scaffold_4770 13507397 56 - 17746568 GGCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUAGUAUAAUGUCGCCGGCGAUCUC (.((((.((((((((....(((.....)))....)))))))).).))).)...... ( -17.40, z-score = -0.84, R) >dp4.chr2 23808219 56 + 30794189 GCCGGGUCAUUAUGCGCAUGUGUUGCCCAUUAUCGUGUAAUCAUGCCAGAGAUCUC ...(((((....((.(((((.(((((.(......).))))))))))))..))))). ( -14.10, z-score = -0.58, R) >droPer1.super_3 6583416 56 + 7375914 GCCGGGUCAUUAUGCGCAUGUGUUGCCCAUUAUCGUGUAAUCAUGCCAGAGAUCUC ...(((((....((.(((((.(((((.(......).))))))))))))..))))). ( -14.10, z-score = -0.58, R) >consensus GCCGGGUCAUUAUGCGCAUGUGUCGCCCAUUAUCGUAUAAUGUCGCCGGCGAUCUC ((((((.(((((((((...(((.....)))...))))))))).).)))))...... (-16.12 = -16.86 + 0.74)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:32:50 2011