| Sequence ID | dm3.chr3R |
|---|---|
| Location | 16,827,885 – 16,827,939 |
| Length | 54 |
| Max. P | 0.895606 |
| Location | 16,827,885 – 16,827,939 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 97.53 |
| Shannon entropy | 0.03401 |
| G+C content | 0.37654 |
| Mean single sequence MFE | -11.23 |
| Consensus MFE | -10.55 |
| Energy contribution | -10.67 |
| Covariance contribution | 0.11 |
| Combinations/Pair | 1.07 |
| Mean z-score | -1.90 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.12 |
| SVM RNA-class probability | 0.895606 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 16827885 54 - 27905053 UUUCGAGUGAUUUUGAGUGGCUUAUCCCUGAAUGUGAGCUAUAAAGUUAUGAAG ......((((((((..(((((((((........))))))))))))))))).... ( -12.30, z-score = -2.51, R) >droSec1.super_38 103181 54 + 400794 UUUCGAGUGAUUUCGAGUUGCUUAUCCCUGAAUGUGAGCUAUAAAGUUAUGAAG .((((((....))))))..((((((........))))))............... ( -9.00, z-score = -1.07, R) >droSim1.chr3R 22886992 54 + 27517382 UUUCGAGUGAUUUCGAGUGGCUUAUCCCUGAAUGUGAGCUAUAAAGUUAUGAAG ..(((((....)))))(((((((((........)))))))))............ ( -12.40, z-score = -2.14, R) >consensus UUUCGAGUGAUUUCGAGUGGCUUAUCCCUGAAUGUGAGCUAUAAAGUUAUGAAG ..(((((....)))))(((((((((........)))))))))............ (-10.55 = -10.67 + 0.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:31:23 2011