| Sequence ID | dm3.chr3R |
|---|---|
| Location | 16,814,647 – 16,814,740 |
| Length | 93 |
| Max. P | 0.907590 |
| Location | 16,814,647 – 16,814,740 |
|---|---|
| Length | 93 |
| Sequences | 6 |
| Columns | 95 |
| Reading direction | reverse |
| Mean pairwise identity | 59.79 |
| Shannon entropy | 0.77646 |
| G+C content | 0.35794 |
| Mean single sequence MFE | -13.78 |
| Consensus MFE | -5.98 |
| Energy contribution | -5.93 |
| Covariance contribution | -0.05 |
| Combinations/Pair | 1.67 |
| Mean z-score | -1.02 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.19 |
| SVM RNA-class probability | 0.907590 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 16814647 93 - 27905053 UAAAAGUGUAUUUUUAAUUAUUGUGGAAAUAUAUUUCCGCAGCUCUGCUGCUCAAUG--CCAAACCAUUCGUAAUGUACUAUUUCCCCCAACUAU ...(((((((((((((.......)))))))))))))..(((((...)))))......--.................................... ( -13.40, z-score = -1.16, R) >droSec1.super_38 89530 92 + 400794 UAAAAGCGUAUUUUUAAUUAUUGUGGAAAUAUAUUUCCGCAGCUCUGCUGCUCAAUG--CCAACCCAUUCGUAAUGUACUAUUUCCCCUUCUAG- .....(((..........(((((.(((((....)))))(((((...))))).)))))--..........)))......................- ( -14.05, z-score = -1.49, R) >droYak2.chr3R 5606756 89 - 28832112 UAUAAGUGUAUUUUUAAUUAUUGUGGAAAUAAAUUUCCGCAGCUUUACUGCUCAAUGCCCCAACCCUCUCCUAAUGUACUAUUUACCCU------ ..(((((((((..(((.....((((((((....))))))))((......))....................))).)))).)))))....------ ( -13.10, z-score = -2.24, R) >droEre2.scaffold_4770 12904430 87 + 17746568 UGAAAGCGUAGUUUUAAUUAUUGUGGAAAUAUAUUUCCGUAGCUUUACUGCUCGAUG--CCAACCCUUUCCUAAUGUACUAUUUCCCCU------ .(((((.((...............(((((....)))))(.(((......))))....--...)).)))))...................------ ( -11.30, z-score = -0.48, R) >droAna3.scaffold_13340 8070084 88 - 23697760 -UAAAAAGCAUGCCUAGCUGAGCAAGCAAU-UAUUAGCUAAUGUUUCUUAAUCGAAUGUUUAUCCAUUUCUGCGCUAAACAAUAGCCGUU----- -......((.((((.....).))).))...-.....((((.(((((.......(((((......))))).......))))).))))....----- ( -14.54, z-score = 0.28, R) >droGri2.scaffold_15116 1609858 93 + 1808639 UAAGAGAGACUUUUUAACCACCGUGGCACUUUGGUGUCGCAUUCGUCUUGCAUUUCGCCAUGAACUUUUUUU--UUUAUUGUUCAUCCUAAUUAU .(((((((..............(((((((....))))))).(((((...((.....)).)))))))))))).--..................... ( -16.30, z-score = -1.02, R) >consensus UAAAAGAGUAUUUUUAAUUAUUGUGGAAAUAUAUUUCCGCAGCUUUACUGCUCAAUG__CCAACCCUUUCCUAAUGUACUAUUUCCCCU______ ....................(((((((((....)))))))))..................................................... ( -5.98 = -5.93 + -0.05)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:31:20 2011