| Sequence ID | dm3.chr3R |
|---|---|
| Location | 16,719,125 – 16,719,175 |
| Length | 50 |
| Max. P | 0.974687 |
| Location | 16,719,125 – 16,719,175 |
|---|---|
| Length | 50 |
| Sequences | 8 |
| Columns | 51 |
| Reading direction | forward |
| Mean pairwise identity | 90.59 |
| Shannon entropy | 0.18695 |
| G+C content | 0.35824 |
| Mean single sequence MFE | -11.99 |
| Consensus MFE | -10.73 |
| Energy contribution | -10.60 |
| Covariance contribution | -0.13 |
| Combinations/Pair | 1.17 |
| Mean z-score | -2.27 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.91 |
| SVM RNA-class probability | 0.974687 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 16719125 50 + 27905053 AGACCAAGUAUUUGCUCUGUAAUUUAUAUGCGCACAGCAGAUACCAAAAU- .......(((((((((.(((.((....))..))).)))))))))......- ( -12.20, z-score = -3.09, R) >droPer1.super_0 7735799 51 + 11822988 AAGCCAAGUAUUUGCUCUGCAAUUUAUAUGCGUACAGCAGAUACCAAAAAU .......(((((((((.((((.......))))...)))))))))....... ( -12.30, z-score = -2.60, R) >dp4.chr2 18071886 51 - 30794189 AAGCCAAGUAUUUGCUCUGCAAUUUAUAUGCGUACAGCAGAUACCAAAAAU .......(((((((((.((((.......))))...)))))))))....... ( -12.30, z-score = -2.60, R) >droAna3.scaffold_13340 7980728 50 + 23697760 GCAUGAAGUAUUUUCUCUGUAAUUUAUAUGCGCAGAGCAGAUACCAAAAU- .......((((((.((((((.((....))..)))))).))))))......- ( -11.80, z-score = -2.37, R) >droEre2.scaffold_4770 12808419 50 - 17746568 AAGUCAAGUAUUUGCUCUGUAAUUUAUAUGCGCACAGCAGAUACCAAAAU- .......(((((((((.(((.((....))..))).)))))))))......- ( -12.20, z-score = -2.79, R) >droYak2.chr3R 5522855 50 + 28832112 AGGCCAAGUAUUUGCUCUGUAAUUUAUAUGUGCACAGCAGAUACCAAAAU- .......(((((((((.((((.........)))).)))))))))......- ( -12.90, z-score = -2.20, R) >droSec1.super_27 784064 50 - 799419 AGGCCAAGUAUUUGCUCUGUAAUUUAUAUGCGCACAGCAGAUAGCAAAAU- ..((....((((((((.(((.((....))..))).)))))))))).....- ( -10.00, z-score = -0.47, R) >droSim1.chr3R 22775722 50 - 27517382 AGGCCAAGUAUUUGCUCUGUAAUUUAUAUGCGCACAGCAGAUACCAAAAU- .......(((((((((.(((.((....))..))).)))))))))......- ( -12.20, z-score = -2.03, R) >consensus AGGCCAAGUAUUUGCUCUGUAAUUUAUAUGCGCACAGCAGAUACCAAAAU_ .......(((((((((.(((...........))).)))))))))....... (-10.73 = -10.60 + -0.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:31:06 2011