| Sequence ID | dm3.chr3R |
|---|---|
| Location | 16,314,099 – 16,314,150 |
| Length | 51 |
| Max. P | 0.878082 |
| Location | 16,314,099 – 16,314,150 |
|---|---|
| Length | 51 |
| Sequences | 7 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 73.31 |
| Shannon entropy | 0.47293 |
| G+C content | 0.45059 |
| Mean single sequence MFE | -14.01 |
| Consensus MFE | -6.64 |
| Energy contribution | -7.13 |
| Covariance contribution | 0.50 |
| Combinations/Pair | 1.36 |
| Mean z-score | -2.04 |
| Structure conservation index | 0.47 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.03 |
| SVM RNA-class probability | 0.878082 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 16314099 51 - 27905053 UGUGGAUGUGGAUGUCGUGCCCUUGGUUU-----UGGGUAUAAUUAAAUUCCGCUU .(((((....(((...((((((.......-----.)))))).)))....))))).. ( -16.20, z-score = -3.00, R) >droSim1.chr3R 22356569 51 + 27517382 UGUGGAUGUGGAUGUCGUGCCCUUGGUUU-----UGGGUAUAAUUAAAUUCCGCUU .(((((....(((...((((((.......-----.)))))).)))....))))).. ( -16.20, z-score = -3.00, R) >droSec1.super_27 375871 51 + 799419 UGUGGAUGUGGAUGUCGUGCCCUUGGUUU-----UGGGUAUAAUUAAAUUCCGCUU .(((((....(((...((((((.......-----.)))))).)))....))))).. ( -16.20, z-score = -3.00, R) >droYak2.chr3R 5092603 50 - 28832112 UGUGGAUGUGGAUUUCGUGCCCUUGG-UU-----UGGGUAUAAUUAAAUUCCGCUU .(((((....((((..((((((....-..-----.))))))))))....))))).. ( -16.00, z-score = -2.96, R) >droEre2.scaffold_4770 12388662 50 + 17746568 UGUGGAUGUGGAUGUCGUGCCCUUGG-UU-----AGGGUAUAAUUAAAUUCCGCUU .(((((....(((...(((((((...-..-----))))))).)))....))))).. ( -17.10, z-score = -3.22, R) >dp4.chr2 15477257 55 - 30794189 -ACCUGCCACAACCCCUUUUGCCUGGACCAUCCACGGGGAUAAUUAAAUUCCGCUU -....((..............(((((.....))).))(((.........))))).. ( -8.20, z-score = 0.58, R) >droPer1.super_0 6887218 55 + 11822988 -ACCUGCCACAACCCCUUUUGCCUGGACUAUCCACGGGGAUAAUUAAAUUCCGCUU -....((..............(((((.....))).))(((.........))))).. ( -8.20, z-score = 0.32, R) >consensus UGUGGAUGUGGAUGUCGUGCCCUUGGUUU_____UGGGUAUAAUUAAAUUCCGCUU .(((((....(((...((((((.............)))))).)))....))))).. ( -6.64 = -7.13 + 0.50)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:30:00 2011