| Sequence ID | dm3.chr2L |
|---|---|
| Location | 8,109,700 – 8,109,790 |
| Length | 90 |
| Max. P | 0.945588 |
| Location | 8,109,700 – 8,109,790 |
|---|---|
| Length | 90 |
| Sequences | 7 |
| Columns | 91 |
| Reading direction | reverse |
| Mean pairwise identity | 87.77 |
| Shannon entropy | 0.22450 |
| G+C content | 0.30805 |
| Mean single sequence MFE | -17.31 |
| Consensus MFE | -14.27 |
| Energy contribution | -14.31 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.18 |
| Structure conservation index | 0.82 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.51 |
| SVM RNA-class probability | 0.945588 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 8109700 90 - 23011544 UCGACAAUUCAUAUGGAUAGUUAUG-GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUUAUUAGCUUUCCAUGAUUAUCAGCUAAGACGAAU (((.((.......))((((((((((-((((..(((....((((((.......)))))).)))..))))))))))))))........))).. ( -19.80, z-score = -3.34, R) >droSim1.chr2L 7889211 90 - 22036055 UCGACAAUUCAUAUGGAUAGUUAUG-GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUGAUUAGCUUUCCAUGAUUAUCAGCUAGGACGAAU (((....(((.....((((((((((-((((..(((.....(((((.......)))))..)))..)))))))))))))).....)))))).. ( -20.20, z-score = -3.03, R) >droSec1.super_3 3606078 87 - 7220098 ---UCAAUUCAUAUGGAUAGUUAUG-GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUGAUUAGCUUUCCAUGAUUAUCAGCUAGGACGAAU ---............((((((((((-((((..(((.....(((((.......)))))..)))..))))))))))))))............. ( -19.50, z-score = -2.89, R) >droYak2.chr2L 10740500 90 - 22324452 UCGACAAUUCAUAUGGAUAGUUAUG-GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUGAUUAGCUUUCCAUGAUUAUCGGCUAGGACGAAU (((....(((...(.((((((((((-((((..(((.....(((((.......)))))..)))..)))))))))))))).)...)))))).. ( -19.90, z-score = -2.70, R) >droEre2.scaffold_4929 17015510 90 - 26641161 UCGACAAUUCAUAUGGAUAGUUAUG-GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUGAUUAGCUUUUCAUGAUUAUCGGCUAAGACGAAU (((.((.......))((((((((((-..((..(((.....(((((.......)))))..)))..))..))))))))))........))).. ( -17.30, z-score = -2.08, R) >dp4.chr4_group4 5630734 85 + 6586962 ------AUUUAUACGGAUAUUAAUGCGAAAAAUAAGAAAAGAAUGGAGAAGACGUUUGAUUAGCUUUCCAUGAUUAUCGACUACGACGAAU ------.........((((...(((.((((..(((.....(((((.......)))))..)))..)))))))...))))............. ( -11.20, z-score = -0.20, R) >droPer1.super_46 102846 85 - 590583 ------AUUUAUACGGAUAUUAAUGGGAAAAAUAAGAAAAGAAUGGAGAAGACGUUUGAUUAGCUUUCCAUGAUUAUCGACUACGACGAAU ------.........((((...(((((((...(((.....(((((.......)))))..)))..)))))))...))))............. ( -13.30, z-score = -1.04, R) >consensus UCGACAAUUCAUAUGGAUAGUUAUG_GGAAAAUAAGAAAAGAAUGAAAGAUACAUUUGAUUAGCUUUCCAUGAUUAUCGGCUAGGACGAAU ...............((((((((((.((((..(((.....(((((.......)))))..)))..))))))))))))))............. (-14.27 = -14.31 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:25:06 2011