| Sequence ID | dm3.chr3R |
|---|---|
| Location | 16,134,526 – 16,134,601 |
| Length | 75 |
| Max. P | 0.977293 |
| Location | 16,134,526 – 16,134,601 |
|---|---|
| Length | 75 |
| Sequences | 4 |
| Columns | 75 |
| Reading direction | reverse |
| Mean pairwise identity | 69.96 |
| Shannon entropy | 0.48124 |
| G+C content | 0.32239 |
| Mean single sequence MFE | -19.00 |
| Consensus MFE | -11.88 |
| Energy contribution | -10.88 |
| Covariance contribution | -1.00 |
| Combinations/Pair | 1.43 |
| Mean z-score | -1.92 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.97 |
| SVM RNA-class probability | 0.977293 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 16134526 75 - 27905053 UUAUUUUUUGUGGAAGUGAGCCGAUUUUUACGAAAAAAUAAAGAAUUUACUUCUCUCGUUUUUUUUUAGAAAUGG ...((((((((((((((......))))))))))))))...................(((((((....))))))). ( -13.20, z-score = -0.80, R) >droSim1.chr3R 22171437 71 + 27517382 UUUUUUUUUGUGGAAGUGAGUCCAUUUUUACGAAAAAAGAGAGAAUUUCCUCCUCUC----CUUUUUAGGAAUAG ((((((((((((((((((....))))))))))))))))))(((......)))...((----((....)))).... ( -20.30, z-score = -2.69, R) >droSec1.super_27 196239 71 + 799419 UUUUUUUUUGUGGAAGUGAGUCCAUUUUUACGAUAAAAGAGAGAAUUUCCUCCUCUC----CUUUUUAGGAAUAG ((((((.(((((((((((....))))))))))).))))))(((......)))...((----((....)))).... ( -17.00, z-score = -1.66, R) >droPer1.super_95 61690 72 + 176753 ---UUUUUUGGGGGGGGGCGCGGCCUUCUCCCAAAAAAAAAAAUUUUGGGGUCUCUUUUUUUUUUUCAAAAAAAA ---((((((((((((((((...)))))))))))))))).....(((((..(............)..))))).... ( -25.50, z-score = -2.52, R) >consensus UUUUUUUUUGUGGAAGUGAGCCCAUUUUUACGAAAAAAGAAAGAAUUUCCUCCUCUC____CUUUUUAGAAAUAG ...((((((((((((((......))))))))))))))...................................... (-11.88 = -10.88 + -1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:29:32 2011