| Sequence ID | dm3.chr2L |
|---|---|
| Location | 8,086,674 – 8,086,733 |
| Length | 59 |
| Max. P | 0.723223 |
| Location | 8,086,674 – 8,086,733 |
|---|---|
| Length | 59 |
| Sequences | 7 |
| Columns | 76 |
| Reading direction | forward |
| Mean pairwise identity | 76.00 |
| Shannon entropy | 0.39169 |
| G+C content | 0.35916 |
| Mean single sequence MFE | -13.89 |
| Consensus MFE | -6.75 |
| Energy contribution | -6.96 |
| Covariance contribution | 0.21 |
| Combinations/Pair | 1.25 |
| Mean z-score | -2.10 |
| Structure conservation index | 0.49 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.723223 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 8086674 59 + 23011544 ----------------GCGAACAGCUGAUUUCAUAUUUGCUCUCGCAAA-UUUGUAAAAAUAAAUACGGCUGACCA ----------------.....((((((((((((.((((((....)))))-).)).......)))).)))))).... ( -13.91, z-score = -2.70, R) >droEre2.scaffold_4929 16992194 59 + 26641161 ----------------GCAAACAGCUGAUUUCAUAUUUGCUCUCGCAAA-UUUGUAAAAAUAAAUACGGCUGACCA ----------------.....((((((((((((.((((((....)))))-).)).......)))).)))))).... ( -13.91, z-score = -2.94, R) >droYak2.chr2L 10716702 59 + 22324452 ----------------GCAAACAGCUGAUUUCAUAUUUGCUCUCGCAAA-UUUGUAAAAAUAAAUACGGCUGACCA ----------------.....((((((((((((.((((((....)))))-).)).......)))).)))))).... ( -13.91, z-score = -2.94, R) >droSec1.super_3 3583397 59 + 7220098 ----------------GCGAACAGCUGAUUUCAUAUUUGCUCUCGCGAA-UUUGUAAAAAUAAAUACGGCUGACCA ----------------.....((((((((((((.((((((....)))))-).)).......)))).)))))).... ( -13.61, z-score = -2.21, R) >droSim1.chr2L 7867304 59 + 22036055 ----------------GCGAACAGCUGAUUUCAUAUUUGCUCUCGCAAA-UUUGUAAAAAUAAAUACGGCUGACCA ----------------.....((((((((((((.((((((....)))))-).)).......)))).)))))).... ( -13.91, z-score = -2.70, R) >dp4.chr4_group4 5600421 75 - 6586962 GCAAACAGCUGAUUGCGCUGCCGCACAUUUUUAUAUUU-UUCUCGCAAAAUUUGUAAAAAUAAAUAUAGUUGACGA .....((((((..((((....)))).(((((((((..(-((......)))..))))))))).....)))))).... ( -14.00, z-score = -0.60, R) >droPer1.super_46 72688 75 + 590583 GCAAACAGCUGAUUGCGCUGCCGCACAUUUUUAUAUUU-UUCUCGCAAAAUUUGUAAAAAUAAAUAUAGUUGACGA .....((((((..((((....)))).(((((((((..(-((......)))..))))))))).....)))))).... ( -14.00, z-score = -0.60, R) >consensus ________________GCGAACAGCUGAUUUCAUAUUUGCUCUCGCAAA_UUUGUAAAAAUAAAUACGGCUGACCA .....................((((((........(((((....))))).(((((....)))))..)))))).... ( -6.75 = -6.96 + 0.21)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:25:02 2011