| Sequence ID | dm3.chr3R |
|---|---|
| Location | 15,245,784 – 15,245,884 |
| Length | 100 |
| Max. P | 0.844444 |
| Location | 15,245,784 – 15,245,884 |
|---|---|
| Length | 100 |
| Sequences | 3 |
| Columns | 109 |
| Reading direction | reverse |
| Mean pairwise identity | 76.32 |
| Shannon entropy | 0.32395 |
| G+C content | 0.26969 |
| Mean single sequence MFE | -22.17 |
| Consensus MFE | -9.22 |
| Energy contribution | -11.33 |
| Covariance contribution | 2.11 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.93 |
| Structure conservation index | 0.42 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.89 |
| SVM RNA-class probability | 0.844444 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 15245784 100 - 27905053 AGUUUUUCUGCUUUUUUUGUUUUAAAUUUGUAAAUAUAGAAUUUGUUCA-----UUUGGUCCAGCAGUUAUCCCAUAUGUAAGGACCAAGUUAUAAAAA--AAGAUA-- ..........((((((((((..(((((((.........)))))))...(-----((((((((.(((...........)))..))))))))).)))))))--)))...-- ( -19.20, z-score = -2.29, R) >droSim1.chr3R 21294870 101 + 27517382 --------AGUUAUUUCUGCUUUAAGUUUGUAUAUAUAGAAUUUGUAUACAAAUUUUUGUAUAGCCGUUGUCCCAUAUGUAUGGACCAAGUUAUAAAAGAGAAGCUAUA --------((((.(((((((...(((((((((((((.......)))))))))))))..))(((((..(((..((((....))))..))))))))...)))))))))... ( -23.40, z-score = -3.27, R) >droSec1.super_25 306131 103 + 827797 -----UGUUAUAAUUUCUGCUUUAAGUUUGUAUAUAUAGAAUUUGUAUACAAAUUUUUGUAUAGCCGUUGUCCCAUAUGUAUGGACCACGUUAUAAAAGA-AAGCUAUA -----.............((((((((((((((((((.......)))))))))))))...((((((.((.((((.........)))).))))))))....)-)))).... ( -23.90, z-score = -3.22, R) >consensus _____U__UGUUAUUUCUGCUUUAAGUUUGUAUAUAUAGAAUUUGUAUACAAAUUUUUGUAUAGCCGUUGUCCCAUAUGUAUGGACCAAGUUAUAAAAGA_AAGCUAUA ...................(((((((((((((((((.......)))))))))))))...((((((....((((.........))))...)))))))))).......... ( -9.22 = -11.33 + 2.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:27:40 2011