Sequence ID | dm3.chr3R |
---|---|
Location | 15,152,467 – 15,152,528 |
Length | 61 |
Max. P | 0.990975 |
Location | 15,152,467 – 15,152,528 |
---|---|
Length | 61 |
Sequences | 5 |
Columns | 70 |
Reading direction | forward |
Mean pairwise identity | 65.37 |
Shannon entropy | 0.63717 |
G+C content | 0.31526 |
Mean single sequence MFE | -11.36 |
Consensus MFE | -3.64 |
Energy contribution | -4.64 |
Covariance contribution | 1.00 |
Combinations/Pair | 1.22 |
Mean z-score | -1.59 |
Structure conservation index | 0.32 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.02 |
SVM RNA-class probability | 0.505088 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 15152467 61 + 27905053 AAGCAAAAUGCUUAGCAACAUUUAUUGUUGCCAAGAUGA---------GAACCAAAAAUAAAAUUAAAGA ((((.....)))).((((((.....))))))........---------...................... ( -10.00, z-score = -1.81, R) >droSim1.chr3R 21187877 69 - 27517382 AAGCAAAAUGCUUAGCAACAUUAAUUGUUGCCAAGAUAA-GUUGUUGAGAACCAAAAAUGAAAUUAAAGA .(((((....(((.((((((.....)))))).)))....-.)))))........................ ( -13.30, z-score = -2.36, R) >droYak2.chr3R 3871756 70 + 28832112 AAGCAAAAUGCUUAGCAACAUUUCUUGUUGAGAAGACGACUUUGAAGGGAACUCAAAAUCCAAUUUAGCA ..((.((((.(((..(((((.....)))))..)))..((.(((((.(....)))))).))..)))).)). ( -15.10, z-score = -1.55, R) >droEre2.scaffold_4770 11265311 70 - 17746568 AAGCGAAAUGUUUAGCAACAUUUCUCGUUGCCAAGACGAAGUUGAAAAUACCAGAAAAUUAAAUUUACGA .(((((((((((....))))))))(((((.....))))).)))........................... ( -11.30, z-score = -1.30, R) >droVir3.scaffold_13047 16473987 59 + 19223366 AAGGCAAUUGCCUAUCCAUAUCUAUUUCCCGCAAGAUGC-----AAACUAAAUAAAAAUGAAAA------ .((((....)))).................((.....))-----....................------ ( -7.10, z-score = -0.95, R) >consensus AAGCAAAAUGCUUAGCAACAUUUAUUGUUGCCAAGAUGA__UUGAAAAGAACCAAAAAUGAAAUUAAAGA ..........(((.((((((.....)))))).)))................................... ( -3.64 = -4.64 + 1.00)
Location | 15,152,467 – 15,152,528 |
---|---|
Length | 61 |
Sequences | 5 |
Columns | 70 |
Reading direction | reverse |
Mean pairwise identity | 65.37 |
Shannon entropy | 0.63717 |
G+C content | 0.31526 |
Mean single sequence MFE | -13.10 |
Consensus MFE | -6.30 |
Energy contribution | -7.22 |
Covariance contribution | 0.92 |
Combinations/Pair | 1.30 |
Mean z-score | -1.95 |
Structure conservation index | 0.48 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.45 |
SVM RNA-class probability | 0.990975 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 15152467 61 - 27905053 UCUUUAAUUUUAUUUUUGGUUC---------UCAUCUUGGCAACAAUAAAUGUUGCUAAGCAUUUUGCUU .................(((..---------....((((((((((.....))))))))))......))). ( -13.20, z-score = -2.65, R) >droSim1.chr3R 21187877 69 + 27517382 UCUUUAAUUUCAUUUUUGGUUCUCAACAAC-UUAUCUUGGCAACAAUUAAUGUUGCUAAGCAUUUUGCUU ..............................-....((((((((((.....)))))))))).......... ( -12.00, z-score = -2.11, R) >droYak2.chr3R 3871756 70 - 28832112 UGCUAAAUUGGAUUUUGAGUUCCCUUCAAAGUCGUCUUCUCAACAAGAAAUGUUGCUAAGCAUUUUGCUU .((.......(((((((((.....))))))))).............((((((((....)))))))))).. ( -14.60, z-score = -1.51, R) >droEre2.scaffold_4770 11265311 70 + 17746568 UCGUAAAUUUAAUUUUCUGGUAUUUUCAACUUCGUCUUGGCAACGAGAAAUGUUGCUAAACAUUUCGCUU ((((.............(((.....))).....((....)).))))((((((((....)))))))).... ( -11.50, z-score = -1.24, R) >droVir3.scaffold_13047 16473987 59 - 19223366 ------UUUUCAUUUUUAUUUAGUUU-----GCAUCUUGCGGGAAAUAGAUAUGGAUAGGCAAUUGCCUU ------..(((((.(((((((...((-----((.....)))).))))))).))))).((((....)))). ( -14.20, z-score = -2.22, R) >consensus UCUUAAAUUUCAUUUUUAGUUCUCUUCAA__UCAUCUUGGCAACAAUAAAUGUUGCUAAGCAUUUUGCUU ...................................((((((((((.....)))))))))).......... ( -6.30 = -7.22 + 0.92)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:27:30 2011