| Sequence ID | dm3.chr3R |
|---|---|
| Location | 14,757,131 – 14,757,203 |
| Length | 72 |
| Max. P | 0.512523 |
| Location | 14,757,131 – 14,757,203 |
|---|---|
| Length | 72 |
| Sequences | 3 |
| Columns | 74 |
| Reading direction | reverse |
| Mean pairwise identity | 81.82 |
| Shannon entropy | 0.27623 |
| G+C content | 0.42282 |
| Mean single sequence MFE | -9.97 |
| Consensus MFE | -8.40 |
| Energy contribution | -8.73 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.06 |
| Structure conservation index | 0.84 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.04 |
| SVM RNA-class probability | 0.512523 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 14757131 72 - 27905053 CAAAAACUGAACGGAAACCGAAACUGAAACGGAAACUGAAACACUCGAUUGACGACUUAGUGGCUAAGCUAA-- ............(....).(..(((((..((..((.(((.....))).))..))..)))))..)........-- ( -8.50, z-score = -0.94, R) >droSec1.super_5 727284 62 + 5866729 CAAAAACUGAACGGAAACCGAAAUUGAAACGGAAACUGAAACACUCGAUGGACGAGUUAGUG------------ .....(((((.(((...(((.........)))...))).....((((.....))))))))).------------ ( -10.00, z-score = -1.59, R) >droSim1.chr3R 20801849 74 + 27517382 CAAAAACUGAACGGAAACCGAAAUUGAAACGGAAACUGAAACACUCGAUGGACGAGUUAGUGCGGCUAAGCUAA .....(((((.(((...(((.........)))...))).....((((.....)))))))))((......))... ( -11.40, z-score = -0.67, R) >consensus CAAAAACUGAACGGAAACCGAAAUUGAAACGGAAACUGAAACACUCGAUGGACGAGUUAGUG____________ .....(((((.(((...(((.........)))...))).....((((.....)))))))))............. ( -8.40 = -8.73 + 0.33)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:26:18 2011