| Sequence ID | dm3.chr3R |
|---|---|
| Location | 13,646,866 – 13,646,922 |
| Length | 56 |
| Max. P | 0.567000 |
| Location | 13,646,866 – 13,646,922 |
|---|---|
| Length | 56 |
| Sequences | 5 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 73.32 |
| Shannon entropy | 0.46898 |
| G+C content | 0.45993 |
| Mean single sequence MFE | -15.68 |
| Consensus MFE | -7.80 |
| Energy contribution | -7.52 |
| Covariance contribution | -0.28 |
| Combinations/Pair | 1.31 |
| Mean z-score | -1.49 |
| Structure conservation index | 0.50 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.15 |
| SVM RNA-class probability | 0.567000 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 13646866 56 + 27905053 AAUUUGGUUGCAGUGCAGCCUGAAUGGCAUCGCAGUGACAUUUGUCAACUGGCUGG--- ..........((((...(((.....)))....(((((((....))).)))))))).--- ( -16.20, z-score = -0.28, R) >droAna3.scaffold_13340 11632508 55 - 23697760 AUUUAAGCUUCAGUGUGAC-UGAAUGUCAUUCCUGUGACAUUUUUCAACUGGAUUG--- ........((((((.(((.-.(((((((((....))))))))).)))))))))...--- ( -16.90, z-score = -3.50, R) >droEre2.scaffold_4770 9763859 55 - 17746568 AAUUUGGUUGCAGUGCAGC-UGGAUGUCAUCGCAGUGACAUUUGUCAACUGGAUGG--- .(((..(((((...)))))-..)))..((((.(((((((....))).)))))))).--- ( -21.30, z-score = -3.11, R) >droYak2.chr3R 2228279 55 + 28832112 AAUUUGGUUGCAGUGCAGC-GGGAUGUUAUCGCAGUGACAUUUGUCAACUGGAUGG--- .((((.(((((...)))))-.))))..((((.(((((((....))).)))))))).--- ( -17.30, z-score = -2.17, R) >droMoj3.scaffold_6540 31179593 53 - 34148556 AGCUUGGCUCUAGU------UGGAUCUCGUCGCUGUGACAUUUGUCAACCAAUUCGUGG ...(..((....))------..)..(.((......((((....)))).......)).). ( -6.72, z-score = 1.62, R) >consensus AAUUUGGUUGCAGUGCAGC_UGGAUGUCAUCGCAGUGACAUUUGUCAACUGGAUGG___ ..........((((.......(((((((((....)))))))))....))))........ ( -7.80 = -7.52 + -0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:23:29 2011