| Sequence ID | dm3.chr3R |
|---|---|
| Location | 12,531,026 – 12,531,116 |
| Length | 90 |
| Max. P | 0.739523 |
| Location | 12,531,026 – 12,531,116 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 92 |
| Reading direction | reverse |
| Mean pairwise identity | 91.69 |
| Shannon entropy | 0.14587 |
| G+C content | 0.34586 |
| Mean single sequence MFE | -12.90 |
| Consensus MFE | -10.52 |
| Energy contribution | -10.80 |
| Covariance contribution | 0.28 |
| Combinations/Pair | 1.12 |
| Mean z-score | -1.90 |
| Structure conservation index | 0.82 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.55 |
| SVM RNA-class probability | 0.739523 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 12531026 90 - 27905053 UGUGCUAUUUAUUCACCCAAUUUCUAUUUUUUCUUUGCCUUUUGCUUUGUACAUUUAUCAUUGUGCCUUCAAAUGCACACACACACACAU-- (((((.((((..........................((.....))...(((((........)))))....)))))))))...........-- ( -10.80, z-score = -1.47, R) >droSim1.chr3R 18578105 88 + 27517382 UGUGCUAUUUAUUCACCCAAUUUCUAUUUUUUCUUUGCCUUUUGCUUUGCACAUUUAUCAUUGUGCCUUCAAAUGCACACACACACAU---- (((((.((((..........................((.....))...(((((........)))))....))))))))).........---- ( -12.80, z-score = -2.10, R) >droSec1.super_12 506948 88 + 2123299 UGUGCUAUUUAUUCACCCAAUUUCUAUUUUUUCUUUGCCUUUUGCUUUGCACAUUUAUCAUUGUGCCUUCAAAUGCACACACACACAU---- (((((.((((..........................((.....))...(((((........)))))....))))))))).........---- ( -12.80, z-score = -2.10, R) >droYak2.chr3R 16973122 88 + 28832112 UGUGCUAUUUAUUCACCCAAUUUCUAUUUUUUCUUUGCUUUUUGCUUUGCACAUUUAUCAUUGUGCCUUCAAAUGCACACACACACAU---- (((((.((((..........................((.....))...(((((........)))))....))))))))).........---- ( -14.00, z-score = -2.48, R) >droAna3.scaffold_13340 16343303 91 + 23697760 UGGGCUAUUUAUUCACCCAAUUUCUAUUUUUUUUGUGCCUUUCGC-UCGCACAUUUAUCAUUGUGCCUUCAGUUGCAAAAACACACACACAG ((((...........))))..........(((((((..((.....-..(((((........)))))....))..)))))))........... ( -14.10, z-score = -1.36, R) >consensus UGUGCUAUUUAUUCACCCAAUUUCUAUUUUUUCUUUGCCUUUUGCUUUGCACAUUUAUCAUUGUGCCUUCAAAUGCACACACACACAU____ (((((.((((..........................((.....))...(((((........)))))....)))))))))............. (-10.52 = -10.80 + 0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:20:32 2011