| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,860,594 – 11,860,690 |
| Length | 96 |
| Max. P | 0.760105 |
| Location | 11,860,594 – 11,860,690 |
|---|---|
| Length | 96 |
| Sequences | 5 |
| Columns | 97 |
| Reading direction | forward |
| Mean pairwise identity | 79.85 |
| Shannon entropy | 0.32758 |
| G+C content | 0.32721 |
| Mean single sequence MFE | -12.77 |
| Consensus MFE | -8.12 |
| Energy contribution | -9.22 |
| Covariance contribution | 1.10 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.89 |
| Structure conservation index | 0.64 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.61 |
| SVM RNA-class probability | 0.760105 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11860594 96 + 27905053 GAUACGAUUAUUUAUUUACGCUUCCCAACGCGACCGUCCAUAUCAAUAACA-UAACUAGCUGUACAGCAGAAUCGUAUCAAAUCGAAUAUAUCCAAA (((((((((.........(((........)))...................-...((.(((....)))))))))))))).................. ( -17.80, z-score = -3.10, R) >droSim1.chr3R 17901378 80 - 27517382 GAUACGAUUAUUUAUUAACG----------------UCCAUAUCAAUAACA-UAACUAGCUGUAAAGCAGAAUCGUAUCAAAUCGAAUAUAUCGAAA (((((((((..(((((....----------------........)))))..-...((.(((....))))))))))))))...((((.....)))).. ( -15.30, z-score = -2.73, R) >droSec1.super_0 11022149 80 - 21120651 GAAACGAUUAUUUAUUAACG----------------UCCAUAUCAAUAACA-UAACUAGCUGUAAAGCAGAAUCGUAUCAAAUCGAAUAUAUCGAAA ((.((((((..(((((....----------------........)))))..-...((.(((....))))))))))).))...((((.....)))).. ( -11.20, z-score = -1.31, R) >droYak2.chr3R 14257590 88 - 28832112 GAUACGAUUAUUUAUUUACGCUUCCCAACGCC----AGCGU--UCAUAUCAAUAACUAGCUGUA---CAGAAUCGAAUCAAAUCAAAUAUAUCCAAA (((.(((((..........((........))(----(((..--...............))))..---...))))).))).................. ( -10.83, z-score = -1.55, R) >droEre2.scaffold_4770 11382729 90 + 17746568 GAUACGAUUACUUAUUAACGCUUCCCAACGCA----ACCGUAUCCAUAUCAAUAACUAGCUGUA---CAGAAUCGAAUCAAAUCGAAUAUAUCCAAA (((.(((((.((.......((........)).----...((((...((........))...)))---)))))))).))).................. ( -8.70, z-score = -0.75, R) >consensus GAUACGAUUAUUUAUUAACGCUUCCCAACGC_____UCCAUAUCAAUAACA_UAACUAGCUGUA_AGCAGAAUCGUAUCAAAUCGAAUAUAUCCAAA (((((((((..........((........))............................(((.....)))))))))))).................. ( -8.12 = -9.22 + 1.10)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:18:46 2011