| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,774,561 – 11,774,619 |
| Length | 58 |
| Max. P | 0.952892 |
| Location | 11,774,561 – 11,774,619 |
|---|---|
| Length | 58 |
| Sequences | 4 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 67.42 |
| Shannon entropy | 0.53548 |
| G+C content | 0.29486 |
| Mean single sequence MFE | -9.80 |
| Consensus MFE | -6.10 |
| Energy contribution | -6.60 |
| Covariance contribution | 0.50 |
| Combinations/Pair | 1.36 |
| Mean z-score | -1.43 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.59 |
| SVM RNA-class probability | 0.952892 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11774561 58 - 27905053 UUUUUCUCACUACUAA-UUUUUUGCAGAAUUUUCCAACUAGAAUGUUGCAGAAAAUACU ...............(-((((((((((.(((((......))))).)))))))))))... ( -11.20, z-score = -3.03, R) >droSim1.chr3R 17813580 58 + 27517382 CUUUUUUCACUUCUAG-UUUUUUGCAGAAUUUCCCAGUUAAAAUGUUGCAGAAAAUGCU ...............(-((((((((((.((((........)))).)))))))))))... ( -10.50, z-score = -1.50, R) >droSec1.super_0 10936594 59 + 21120651 UUUUUUUCACUCCUAGUUUUUUUGCAGAAUUUCCUAGCUAGAAUGUUGCAGAAAAUACU ..............(((((((((((((...(((.......)))..)))))))))).))) ( -10.40, z-score = -1.46, R) >droGri2.scaffold_15074 6020154 59 - 7742996 UUCUUCAAGCAAAUAUUAUUUUUGUUUAUUGAAUAACCAGAGCUGAAGCAUAGCAUACU (((...(((((((.......)))))))...)))........((((.....))))..... ( -7.10, z-score = 0.26, R) >consensus UUUUUCUCACUACUAG_UUUUUUGCAGAAUUUCCCAGCUAAAAUGUUGCAGAAAAUACU .................((((((((((.((((........)))).)))))))))).... ( -6.10 = -6.60 + 0.50)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:18:37 2011