| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,654,126 – 11,654,205 |
| Length | 79 |
| Max. P | 0.625668 |
| Location | 11,654,126 – 11,654,205 |
|---|---|
| Length | 79 |
| Sequences | 5 |
| Columns | 84 |
| Reading direction | forward |
| Mean pairwise identity | 92.00 |
| Shannon entropy | 0.13248 |
| G+C content | 0.28644 |
| Mean single sequence MFE | -18.28 |
| Consensus MFE | -14.76 |
| Energy contribution | -15.00 |
| Covariance contribution | 0.24 |
| Combinations/Pair | 1.05 |
| Mean z-score | -1.85 |
| Structure conservation index | 0.81 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.28 |
| SVM RNA-class probability | 0.625668 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11654126 79 + 27905053 AUUAUAUCAUCGUGUAAAUAAUGUUUCUUUGCAUUAGCAUCCAAAAAGUGUUAUGCAUUUA-----AUGGCGAUGAGGUAAUAC (((((.(((((((.....((((((......)))))).....((..(((((.....))))).-----.))))))))).))))).. ( -18.50, z-score = -2.32, R) >droSim1.chr3R 17694997 79 - 27517382 AUUAUAUCAUUGUGUAAAUAAUGUUUAUUUGCAUUAGCAUCCAAAAAGUGUUAUGCAUUUA-----AUGGCGAUGAGGUAAUAC (((((.((((((((((((((.....)))))))).......(((..(((((.....))))).-----.))))))))).))))).. ( -17.20, z-score = -1.47, R) >droSec1.super_0 10820056 79 - 21120651 AUUAUAUCAUUGUGUAAAUAAUGUUUAUUUGCAUUAGCAUCCAAAAAGUGUUAUGCAUUUA-----AUGGCGAUGAGGUAAUAC (((((.((((((((((((((.....)))))))).......(((..(((((.....))))).-----.))))))))).))))).. ( -17.20, z-score = -1.47, R) >droYak2.chr3R 14048794 84 - 28832112 AUUAUAUCAUUGUGUAAAUAAUGUUUCUUUGAAUUAGCAUUCAAAAAGCGUUAUGCAUUCAUUUUUAUGGCGAUGAGGUAAUGC (((((.(((((((....(((((((((.(((((((....)))))))))))))))).(((........)))))))))).))))).. ( -20.40, z-score = -2.24, R) >droEre2.scaffold_4770 11176505 84 + 17746568 UUUAUAUCAUUGUGUAAAUAAUGUUUCUUUGCAUUAGCAUCCAAAAAGUGUUAUGCAUUCAUUUUUAUGGCGAUGAGGUAAUAC .((((.((((((((((((.((((......(((((.(((((.......))))))))))..))))))))).))))))).))))... ( -18.10, z-score = -1.77, R) >consensus AUUAUAUCAUUGUGUAAAUAAUGUUUCUUUGCAUUAGCAUCCAAAAAGUGUUAUGCAUUUA_____AUGGCGAUGAGGUAAUAC (((((.(((((((.....((((((......))))))((((............)))).............))))))).))))).. (-14.76 = -15.00 + 0.24)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:18:21 2011