| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,583,923 – 11,583,983 |
| Length | 60 |
| Max. P | 0.861956 |
| Location | 11,583,923 – 11,583,983 |
|---|---|
| Length | 60 |
| Sequences | 5 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 95.92 |
| Shannon entropy | 0.06846 |
| G+C content | 0.45207 |
| Mean single sequence MFE | -12.98 |
| Consensus MFE | -11.82 |
| Energy contribution | -11.82 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.89 |
| Structure conservation index | 0.91 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.96 |
| SVM RNA-class probability | 0.861956 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11583923 60 + 27905053 CCCAGUGCGCCAACAAGCAACAACAAAGGCAAGAAAAGCAGACUUUUCUUUUCGGAAAAG .((..(((........)))........((.((((((((....)))))))).))))..... ( -12.10, z-score = -1.25, R) >droSim1.chr3R 17615356 58 - 27517382 CCCAG--CGCCAACAAGCAACAACAAAGGCAAGAAAAGCAGACUUUUCUUUUCGGAAAAG .((.(--(........)).........((.((((((((....)))))))).))))..... ( -11.40, z-score = -1.70, R) >droSec1.super_0 10750356 58 - 21120651 CCCAG--CGCCAACAAGCAACAACAAAGGCAAGAAAAGCAGACUUUUCUUUUCGGAAAAG .((.(--(........)).........((.((((((((....)))))))).))))..... ( -11.40, z-score = -1.70, R) >droYak2.chr3R 13977297 58 - 28832112 GCCAG--CGCCAACAAGCAACAACAAAGGGAAGAAAAGCAGACUUUUCUUUUCGGAAAAG .((.(--(........)).........(..((((((((....))))))))..)))..... ( -15.00, z-score = -2.70, R) >droEre2.scaffold_4770 11094623 58 + 17746568 GCCAG--CGCCAACAAGCAACAACAAAGGGAAGAAAAGCGGACUUUUCUUUUCGGAAAAG .((.(--(........)).........(..((((((((....))))))))..)))..... ( -15.00, z-score = -2.12, R) >consensus CCCAG__CGCCAACAAGCAACAACAAAGGCAAGAAAAGCAGACUUUUCUUUUCGGAAAAG .((.....((......)).........(..((((((((....))))))))..)))..... (-11.82 = -11.82 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:18:16 2011