| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,544,903 – 11,544,965 |
| Length | 62 |
| Max. P | 0.995320 |
| Location | 11,544,903 – 11,544,965 |
|---|---|
| Length | 62 |
| Sequences | 6 |
| Columns | 62 |
| Reading direction | reverse |
| Mean pairwise identity | 63.15 |
| Shannon entropy | 0.72749 |
| G+C content | 0.36687 |
| Mean single sequence MFE | -10.20 |
| Consensus MFE | -5.28 |
| Energy contribution | -6.12 |
| Covariance contribution | 0.84 |
| Combinations/Pair | 1.62 |
| Mean z-score | -1.59 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.79 |
| SVM RNA-class probability | 0.995320 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11544903 62 - 27905053 AAAAUUUAAUAUACUUAAAAAAGCAUGCAACACCAAAGUUGCACGGUUGUCUCUGACCCACA .........................((((((......)))))).((((......)))).... ( -10.30, z-score = -1.54, R) >droAna3.scaffold_13340 16150782 51 - 23697760 ---------GAAAUUGAAACCAUAACAAAGAAUUAAAGUUU--UUGCGGCUUUUGCCCCACA ---------................((((((.......)))--))).(((....)))..... ( -5.30, z-score = 0.10, R) >droYak2.chr3R 13940923 61 + 28832112 CAAAUUUAAUAUAC-UAAAAAACCAUGCAACACCAAAGUUGCAUGCAUGACUAUGACCCACA ..............-........((((((((......))))))))................. ( -10.70, z-score = -3.40, R) >droSec1.super_0 10715202 62 + 21120651 CAAAUUUAAUAUACUUAAAAAAGCAUGCAACGCCAAAGUUGCAUGGCUGUCUCUGACCCACA .....................((((((((((......))))))).))).............. ( -12.90, z-score = -2.00, R) >droSim1.chr3R 17579864 62 + 27517382 CAAAUUUAAUAUACUUAAAAAAGCAUGCAACGCCAAAGUUGCAUGGCUGUCUCUGACCCACA .....................((((((((((......))))))).))).............. ( -12.90, z-score = -2.00, R) >droGri2.scaffold_14906 4846767 56 + 14172833 AAAGCUUAAUACAUACAAAGGAUUGUGGAUUGCGGUAG------GAUGAUUGUUGAAGCACA ...((((...(((..((....(((((.....)))))..------..))..)))..))))... ( -9.10, z-score = -0.70, R) >consensus CAAAUUUAAUAUACUUAAAAAAGCAUGCAACACCAAAGUUGCAUGGCUGUCUCUGACCCACA .......................((((((((......))))))))................. ( -5.28 = -6.12 + 0.84)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:18:10 2011