| Sequence ID | dm3.chr3R |
|---|---|
| Location | 11,137,614 – 11,137,720 |
| Length | 106 |
| Max. P | 0.668481 |
| Location | 11,137,614 – 11,137,720 |
|---|---|
| Length | 106 |
| Sequences | 6 |
| Columns | 110 |
| Reading direction | reverse |
| Mean pairwise identity | 74.71 |
| Shannon entropy | 0.46944 |
| G+C content | 0.32800 |
| Mean single sequence MFE | -23.80 |
| Consensus MFE | -9.51 |
| Energy contribution | -9.73 |
| Covariance contribution | 0.23 |
| Combinations/Pair | 1.26 |
| Mean z-score | -2.07 |
| Structure conservation index | 0.40 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.38 |
| SVM RNA-class probability | 0.668481 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 11137614 106 - 27905053 ----UGUAUAUAUCUAUAUGCUGUGCAUAUGUGUUCGUGCAAUAAAUUUGAGAAUUAAAUGUAAACACAUUUUGUUUGGCGGCUACGCCGAGCAUUCUCAAAAGAUCUCA ----(((((..((.(((((((...))))))).))..))))).....((((((((..((((((....))))))(((((((((....)))))))))))))))))........ ( -33.30, z-score = -4.02, R) >droSim1.chr3R_random 617360 107 - 1307089 UUUAUAUAUGUAUGUAUAUGCUGUGCAUAUGUGUUCGUGCAAUAAAUUUGAGAAUUAAAUGUAAACACAUUUUGUUUG---GCUACGCCGAGCAUUCUCAAAAGAUCUCA (((((.((((.(..(((((((...)))))))..).))))..)))))((((((((..((((((....))))))((((((---((...))))))))))))))))........ ( -28.80, z-score = -2.79, R) >droSec1.super_0 10306257 103 + 21120651 ----UGUAUAUAUCUAUAUGCUGUGCAUAUGUGUUCGUGCAAUAAAUUUGAGAAUUAAAUGUAAACACAUUUUGUUUG---GCUACGCCGAGCAUUCUCAAAAGAUCUCA ----(((((..((.(((((((...))))))).))..))))).....((((((((..((((((....))))))((((((---((...))))))))))))))))........ ( -28.40, z-score = -3.15, R) >droYak2.chr3R 13536868 101 + 28832112 ----UGUAUGUACAUAUACCCCGUGCAUAUGUGUUUGUGCAAUAAAUUUGAAAAUUAAAUGUAAACACAUUUUGUUUG---GCUACGCCGAGCAU--UCAAAAGAUCUCA ----((((((.(((((((.........))))))).)))))).....((((((....((((((....))))))((((((---((...)))))))))--)))))........ ( -22.80, z-score = -1.62, R) >droEre2.scaffold_4770 10661737 97 - 17746568 --------UGUACAUAUACCCUGCGCAUAUGUGUUCGUGCAAUAAAUUUGAAAAUUAAAUGUAAACACAUUUUGUUUG---GCUACGCCGAGCAU--UCAAAAGAUCUCA --------(((((..((((...........))))..))))).....((((((....((((((....))))))((((((---((...)))))))))--)))))........ ( -20.10, z-score = -1.12, R) >droGri2.scaffold_14906 901143 81 - 14172833 -----------------GAUAUAUACACAUGCAUACAUAU-AUAAGCCC-AAAGCCAAAUGUAAACAGAUUUUAGUU--------UGCUGAAAAUGUAUAAAAGCUAA-- -----------------....((((((..((..(((((..-....((..-...))...)))))..))..((((((..--------..)))))).))))))........-- ( -9.40, z-score = 0.28, R) >consensus ____UGUAUGUAUAUAUAUGCUGUGCAUAUGUGUUCGUGCAAUAAAUUUGAAAAUUAAAUGUAAACACAUUUUGUUUG___GCUACGCCGAGCAUUCUCAAAAGAUCUCA ..............................(((((((.((...........((((.((((((....)))))).)))).........)))))))))............... ( -9.51 = -9.73 + 0.23)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:17:03 2011