| Sequence ID | dm3.chr3R |
|---|---|
| Location | 10,791,421 – 10,791,500 |
| Length | 79 |
| Max. P | 0.991631 |
| Location | 10,791,421 – 10,791,500 |
|---|---|
| Length | 79 |
| Sequences | 7 |
| Columns | 83 |
| Reading direction | forward |
| Mean pairwise identity | 79.74 |
| Shannon entropy | 0.39618 |
| G+C content | 0.40572 |
| Mean single sequence MFE | -19.97 |
| Consensus MFE | -11.86 |
| Energy contribution | -12.99 |
| Covariance contribution | 1.13 |
| Combinations/Pair | 1.38 |
| Mean z-score | -2.78 |
| Structure conservation index | 0.59 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.49 |
| SVM RNA-class probability | 0.991631 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 10791421 79 + 27905053 GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGUACACCA----GCGCAAGUUUCUAAGUACACACACAGUACGAAAA (((((((..(((..(((((((.....)))))))...(((......----)))...)))..)))))))................ ( -21.50, z-score = -2.98, R) >droSim1.chr3R 16850471 79 - 27517382 GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGCACACCA----ACGCAAGUUUCUGAGUACACACACAGUACAAAAA (((((((..(((..(((((((.....)))))))....((......----..))..)))..)))))))................ ( -22.00, z-score = -3.26, R) >droSec1.super_0 9975735 79 - 21120651 GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGCACACCA----ACGCAAGUUUCUGAGUACACACACAGUACAAAAA (((((((..(((..(((((((.....)))))))....((......----..))..)))..)))))))................ ( -22.00, z-score = -3.26, R) >droYak2.chr3R 13198093 79 - 28832112 GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGCACACCA----ACGCAAGUUCCCAAGUACACACACAGUUCAAAAA ((((((........(((((((.....)))))))...........(----((....)))...))))))................ ( -19.20, z-score = -3.25, R) >droEre2.scaffold_4770 10328248 79 + 17746568 GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGCACACCA----ACGCAAGUUCCUGAGUAAACACACAGUACAAAAA (((((.........(((((((.....)))))))....((.((..(----((....)))..)).))........)))))..... ( -20.00, z-score = -2.73, R) >droAna3.scaffold_13340 5872223 83 + 23697760 GUACUUAAUAACAAGUGCCACACAAUGUGGCACACACGCACACAACAAAAUGCAACAACGUUCAUUUCUACACGGCAAGAAAA ...(((........(((((((.....)))))))....((........(((((.(((...)))))))).......))))).... ( -17.26, z-score = -2.36, R) >droWil1.scaffold_181089 8686419 79 + 12369635 GUACUUAAUAACAAGUGCAACACAAUGCGCCACCUACUACCGUGU----AUGUGUGUAUAUGUAUAUAUAUACAUUUCUAAAA ((((((......)))))).(((((.(((((...........))))----))))))(((((((....))))))).......... ( -17.80, z-score = -1.65, R) >consensus GUACUUAAUAACAAGUGUCGCACAAUGUGGCACAAACGCACACCA____ACGCAAGUUUCUGAGUACACACACAGUACAAAAA (((((((.......(((((((.....)))))))................((....))...)))))))................ (-11.86 = -12.99 + 1.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:16:13 2011