| Sequence ID | dm3.chr3R |
|---|---|
| Location | 10,677,272 – 10,677,325 |
| Length | 53 |
| Max. P | 0.537028 |
| Location | 10,677,272 – 10,677,325 |
|---|---|
| Length | 53 |
| Sequences | 5 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 88.07 |
| Shannon entropy | 0.20959 |
| G+C content | 0.27222 |
| Mean single sequence MFE | -6.10 |
| Consensus MFE | -3.24 |
| Energy contribution | -3.44 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.61 |
| Structure conservation index | 0.53 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.09 |
| SVM RNA-class probability | 0.537028 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 10677272 53 - 27905053 ACUACAAAUAAAGUCUCGUUUAAAUCUAAUGGCACUUUAUCCUAAAAAUACAU .......(((((((.(((((.......))))).)))))))............. ( -6.80, z-score = -3.94, R) >droSim1.chr3R 16731715 53 + 27517382 ACUACAAAUAAAGCGUCGUUAAAAUCUAAUGGCACUUUAUCCUAAAUAUAUAU .......((((((.(((((((.....))))))).))))))............. ( -10.50, z-score = -4.52, R) >droSec1.super_0 9862547 53 + 21120651 ACUACAAAUAAAGCCUCGUUAAAAUCUAAUGGCACUUUAUCCUAAAUAUAUAU .......((((((..((((((.....))))))..))))))............. ( -6.00, z-score = -2.58, R) >droYak2.chr3R 13081187 51 + 28832112 ACUACAGACAAAGACUCGUUAAAAUCCAAUGGCACUUUAUCUUAAACAAAU-- .....(((.((((..(((((.......)))))..)))).))).........-- ( -3.80, z-score = -0.86, R) >droEre2.scaffold_4770 10211861 51 - 17746568 ACUACAAAUAAAGACUCGUUAAAAUCCAAUGGCACUUUAUCUUAAAUAUAU-- .......((((((..(((((.......)))))..))))))...........-- ( -3.40, z-score = -1.15, R) >consensus ACUACAAAUAAAGACUCGUUAAAAUCUAAUGGCACUUUAUCCUAAAUAUAUAU .......((((((..(((((.......)))))..))))))............. ( -3.24 = -3.44 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:15:58 2011