Sequence ID | dm3.chr3R |
---|---|
Location | 10,569,533 – 10,569,593 |
Length | 60 |
Max. P | 0.999294 |
Location | 10,569,533 – 10,569,593 |
---|---|
Length | 60 |
Sequences | 6 |
Columns | 60 |
Reading direction | forward |
Mean pairwise identity | 77.33 |
Shannon entropy | 0.44416 |
G+C content | 0.42350 |
Mean single sequence MFE | -12.92 |
Consensus MFE | -11.13 |
Energy contribution | -10.72 |
Covariance contribution | -0.41 |
Combinations/Pair | 1.50 |
Mean z-score | -2.92 |
Structure conservation index | 0.86 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 3.44 |
SVM RNA-class probability | 0.998666 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 10569533 60 + 27905053 UUGUUUGCCAGUAUUUUUUGCCCAGCUUCGGUUUUUCCCGAAGCUACACACAUUUUCAUG .(((.((...(((.....)))..((((((((......)))))))).)).)))........ ( -14.00, z-score = -3.81, R) >droEre2.scaffold_4770 10103584 60 + 17746568 AUGUUUGCCAGUACUUUUUGCCCAGCUUCGGGUUUUCCCGAAGCUACACACAUUUUUAUG ((((.((.(((......)))...(((((((((....))))))))).)).))))....... ( -17.10, z-score = -4.07, R) >droYak2.chr3R 12970658 59 - 28832112 AUGUUUGCCAGUA-UUUUUGCCCAGCUUCGGUUUUUCCCGAUGCUACACACAUUUUUACG ((((.((...(((-....)))..(((.((((......)))).))).)).))))....... ( -10.30, z-score = -2.13, R) >droSec1.super_0 9756545 60 - 21120651 AUGUUUGCCAGUAUUUUUUGCCCAGCUUCGGAUUUUCCCGAAGCUACACACAUUUUCAUG ((((.((...(((.....)))..((((((((......)))))))).)).))))....... ( -14.90, z-score = -4.07, R) >droSim1.chr3R 16625827 60 - 27517382 AUGUUUGCCAGUAUUUUUUGCCCAGCUUCGGAUUUUCCCGAAGCUACACACAUUUUCAUG ((((.((...(((.....)))..((((((((......)))))))).)).))))....... ( -14.90, z-score = -4.07, R) >droGri2.scaffold_14624 1721388 53 + 4233967 CAUUUUGUGCGUACUCUCAG---AGAGCCAGUCUCUUCUCCUUUUAAGCUCAGUUU---- ....(((.((........((---((((.....))).)))........)).)))...---- ( -6.29, z-score = 0.66, R) >consensus AUGUUUGCCAGUAUUUUUUGCCCAGCUUCGGUUUUUCCCGAAGCUACACACAUUUUCAUG .......................((((((((......))))))))............... (-11.13 = -10.72 + -0.41)
Location | 10,569,533 – 10,569,593 |
---|---|
Length | 60 |
Sequences | 6 |
Columns | 60 |
Reading direction | reverse |
Mean pairwise identity | 77.33 |
Shannon entropy | 0.44416 |
G+C content | 0.42350 |
Mean single sequence MFE | -17.68 |
Consensus MFE | -15.40 |
Energy contribution | -15.73 |
Covariance contribution | 0.34 |
Combinations/Pair | 1.25 |
Mean z-score | -3.55 |
Structure conservation index | 0.87 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 3.77 |
SVM RNA-class probability | 0.999294 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 10569533 60 - 27905053 CAUGAAAAUGUGUGUAGCUUCGGGAAAAACCGAAGCUGGGCAAAAAAUACUGGCAAACAA (((....)))(((.(((((((((......))))))))).))).................. ( -21.20, z-score = -5.20, R) >droEre2.scaffold_4770 10103584 60 - 17746568 CAUAAAAAUGUGUGUAGCUUCGGGAAAACCCGAAGCUGGGCAAAAAGUACUGGCAAACAU ..........(((.((((((((((....)))))))))).))).................. ( -21.90, z-score = -4.65, R) >droYak2.chr3R 12970658 59 + 28832112 CGUAAAAAUGUGUGUAGCAUCGGGAAAAACCGAAGCUGGGCAAAAA-UACUGGCAAACAU .((.......(((.((((.((((......)))).)))).)))....-.....))...... ( -16.79, z-score = -3.39, R) >droSec1.super_0 9756545 60 + 21120651 CAUGAAAAUGUGUGUAGCUUCGGGAAAAUCCGAAGCUGGGCAAAAAAUACUGGCAAACAU (((....)))(((.(((((((((......))))))))).))).................. ( -20.00, z-score = -4.55, R) >droSim1.chr3R 16625827 60 + 27517382 CAUGAAAAUGUGUGUAGCUUCGGGAAAAUCCGAAGCUGGGCAAAAAAUACUGGCAAACAU (((....)))(((.(((((((((......))))))))).))).................. ( -20.00, z-score = -4.55, R) >droGri2.scaffold_14624 1721388 53 - 4233967 ----AAACUGAGCUUAAAAGGAGAAGAGACUGGCUCU---CUGAGAGUACGCACAAAAUG ----.....(.((((....(((((..........)))---))..)))).).......... ( -6.20, z-score = 1.05, R) >consensus CAUGAAAAUGUGUGUAGCUUCGGGAAAAACCGAAGCUGGGCAAAAAAUACUGGCAAACAU ..........(((.(((((((((......))))))))).))).................. (-15.40 = -15.73 + 0.34)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:15:46 2011